How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed for a protein with 45 amino acids? Choose letter that shows cycles. Activation Initiation Elongation Termination A 1 1 43 1 44 1 45 45 43 45 D 45 1 44 E 44 44 44 45
Q: Failed to follow
A: When triglycerides are digested and free fatty acids are liberated, the odor is known as hydrolytic ...
Q: You have a friend who lost 7 kg (about 15 pounds) of fat on a regimen of strict diet and exercise. H...
A: Fats are energy molecules that is usually ester of fatty acids called as triglycerides. It can be so...
Q: Dopamine, norepinephrine and epinephrine are collectively called catecholamines. Which of the follow...
A: Catecholamines are group of hormones made by adrenal glands and its is secreted the chromaffin cells...
Q: Explain briefly the role of the following Vitamin A in vision Vitamin C in collagen formation Vit...
A: Vitamins are micronutrients, which are required in small amounts by the body. Vitamins are classifie...
Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids con...
Q: (d) ( through the disulfide bridge. If this bridge were found for the two joined amino acids free in...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Which of the following condition is NOT associated with riboflavin deficiency? * (Please choose one ...
A: Riboflavin is a water soluble vitamin. It is also called as B2 vitamin. Foods like pork, eggs, chees...
Q: ng glycolysis, t
A: Disclaimer: “Since you have asked multiple question, we will solve the first question for you. If y...
Q: Under what conditions will lactic acid accumulate in skeletal muscle? Select one: A. When NADH is d...
A: A reduction in muscle force generated over time or as a result of pathological conditions is referre...
Q: Enzymes increase the rate of a chemical reaction by providing an alternative path with a lower activ...
A: TRUE
Q: Draw the structure of the phenol derivatives
A: Introduction: Phenols are compounds in which the hydroxyl group is present in the benzene ring. It...
Q: The activity of the enzyme β-galactosidase produced bywild-type cells grown in media supplemented wi...
A: Introduction: In bacteria, the genes involved in the same process are usually clustered together. ...
Q: Study the given structures below. Which of the following are epimers? H 0 H- OH но H- H- HO- но -H H...
A: Epimers are the stereoisomers that differ in arrangement of groups in a single chiral carbon. A chir...
Q: (Part A) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would...
A: The process of translation takes place in the cytoplasm which converts mRNA to protein/en...
Q: Q24. Choose the best answer for the following questions.
A: Amino acids are building blocks of proteins and also important as a precursor for the biosynthesis o...
Q: Explain structural differences between an acidic amino acid and a basic amino acid. How does structu...
A:
Q: II H3N-CH-C–NH-CH-C-NH-CH-C-NH-CH-C-NH-CH-C¬o II ČH,OH CH2 ČH3 CH2 H3C CH3
A: Peptide bonds are formed when the amino or NH2 group of one amino acid bonds to the carboxyl (acid) ...
Q: (a) dues in the polypeptide. Place the label or an arrow on the Ca atom of both residues. Label the ...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: The lock-and-key theory described the action of ______. Select one: a. enzymes as locks that fit oth...
A: Lock-and-key theory describes the formation of an enzyme substrate complex. The complementarity betw...
Q: The molecule shown below is NH2 HO N. Но но
A: Deoxyribonucleic acid (DNA) is a molecule comprised of two polynucleotide chains that wrap around ea...
Q: histidine has three pka values: pka=1.7 pk2=6.0, pka 9.1 a- for each pka, find the equilibrium cons...
A: Consider the acid dissociation reaction at equilibrium; HA⇌H+ + A- here 'HA' is the acid 'H...
Q: Fat storing cells of vertebrates are called hеpatocytes - asterocytes - adipocytes melanocytes
A: Lipids are easily soluble in nonpolar solvents such as benzene, ether, and chlorofor...
Q: Enumerate the five classification of lipids based on function.
A: Lipid, any of a wide range of organic molecules that do not interact significantly with water, such ...
Q: Chapter 15 Reading Question 5
A: The acylation of the three hydroxy groups of glycerol with palmitoleic acid produces 1,2,3-tripalmit...
Q: Which of the following is/are incorrect? - All proteins are polymeric - Not all nucleic acids are...
A: A biomolecule, also called a biological molecule, is a chemical compound found in living organisms. ...
Q: 4. The sequence of a peptide A formed by 16 amino acids was determined using a combination of method...
A: Proteins are chain of amino acids linked by peptide bond with release of a water molecule. Alpha car...
Q: (a) Propose a biosynthetic pathway to the secondary metabolite, B. OH O HO Metabolite B
A: The given metabolite structure is derivative of Salicylaldehyde and synthesized by plant as secondar...
Q: What is the purpose of DNA methylation? Why is it ineffective in the DNA repair of spontaneous deami...
A: DNA methylation is the process of adding methyl groups to DNA at Nucleotide bases, so that without c...
Q: In Figure 12-26, provide a biochemical mechanism forwhy HP-1 can bind to the DNA only on the left si...
A: The family of heterochromatin protein 1 (HP-1) consists of highly conserved proteins which perform a...
Q: HIN A openvellum.ecollege.com 01+| 1叩 Assignments Review I Constants I Periodic Table Part B nts. Wh...
A: Steroids, commonly known as corticosteroids, are anti-inflammatory drugs that are used to treat a va...
Q: Can someone please draw out phosphorylated creatine?
A:
Q: Which of the following contain a correct first statement and an incorrect second statement? Be...
A: G proteins consist of the alpha, beta and gamma receptors for activating the cell signaling mechanis...
Q: 1) What is the chemical group at the end of the R groups of basic amino acids that makes them neutra...
A: There are twenty standard amino acids that make up all of the proteins. The twenty standard amino ac...
Q: Which of the following statements are TRUE? Multiple answers:Multiple answers are accepted for thi...
A: In given Questions many statement given about glycolysis cycle.Glycolysis is the metabolic pathway t...
Q: Draw and name the covalent linkage between two deoxynucleotides. Indicate both the 5’ and 3’ end. Yo...
A: Deoxyribonucleotides are the smallest units present in DNA. DNA is also known as deoxyribonucleic ac...
Q: 14. Naturally occurring fats are A. L types B. D types C. an equi-molar mixture of L and D types D. ...
A: Fat is often used in nutrition, biology, and chemistry to refer to any ester of fatty acids or a com...
Q: What characteristic makes each amino acid unique from one another?
A: Amino acids are organic compounds with functional group namely carboxyl and amino. There are 20 amin...
Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Which of the following is INCORRECTLY paired? O Isoelectric focusing : Charge O Gel filtration chrom...
A: 1. Isoelectric focusing IEF is an electrophoretic method for separating proteins based on their isoe...
Q: SDS-PAGE reagents that play a role in denaturing the protein sample include (Select all that applies...
A: Proteins are present in their globular structure till they don't get denatured by something extraord...
Q: Which of the following is a drawback of using base hydrolysis during amino acid composition? O Proto...
A: A protein is consisted of several amino acids bond together in sequence with peptide bond. To analyz...
Q: 1. What is the physiologic function of pigments in plants?
A: Pigments are compounds that absorb specific wavelengths and reflect away, the other. Plant parts are...
Q: Study the given structures below. Which of the following are enantiomers?" -OH но- H- HO- но- HO- но...
A: Enantiomers are the molecules that are exactly mirror images of each other. They cannot be superimpo...
Q: Paracelsus is famous for saying that “all substances are poisons; there is none which is not a poiso...
A: Poisons are chemicals that have the potential to kill. They are chemicals, either man-made or occurr...
Q: The cell concept CANNOT apply to ____
A: Cell theory (a unifying principle of biology) was formulated by Schleiden and Schwann. Cell theory s...
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial...
A: Vmax is the reaction's maximum speed at which all of the enzymes become saturated with the substrate...
Q: There are two types of nucleic acids-DNA and RNA, both are composed of nucleotide subunits. Complete...
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is a...
Q: The cofactor shown below: NH2 NH2 он -O- он он 1) is an oxidizing agent O 2) is a reducing agent O 3...
A: A cofactor is a non-protein chemical molecule or metallic ion that is required for an enzyme to perf...
Q: Each group will be provided with 20 g double-stranded DNA oligomer in STE buffer (0.1M NaCl/ Tris/ ...
A: Tm, the temperature at which a double stranded DNA is half denatured is dependent on the length and ...
Q: An effort is usually made to purify a protein fırst, before its characteristics are determined. True...
A: Purification of a protein is done to get the interested protein in as native form it can be. Purific...
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…(a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many initiation cycles are needed for a protein with 150 amino acids? (c) How many elongation cycles are needed for a protein with 150 amino acids? (d) How many termination cycles are needed for a protein with 150 amino acids?
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 135'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
- a) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'Biol 1406-Lec 17 - Gene Exp X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Question completion Status. Blackboard Learn Which of the following stater X 9. Which of the following statements about transcription is not true? In both prokaryotes and eukaryotes, pre-mRNA is modified after transcription by adding a 5' cap and a 3' poly-A tail and splicing out introns leaving coding exons. Paraphrasing Tool - QuillBot Your disk is almos Save space by optir O During transcription only one DNA strand called the template strand is read and rewritten by RNA polymerase with the template strand read in the 3' to 5' direction and the mRNA transcript synthesized in the 5' to 3' direction. O During initiation of transcription, RNA polymerase binds to the promoter region in the DNA, unwinds the DNA and binds together RNA nucleotides complementary to the template DNA strand. O During initiation of eukaryotic transcription, the promoter region contains a TATA box in which transcription…
- Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino AcidLike a helices, ß sheets often have one side facing the surface of the protein and one side facing the interior, giving rise to an amphiphilic sheet with one hydrophobic surface and one hydrophilic surface. From the sequences listed below, pick the one that could form a strand in an amphiphilic ß sheet. O TLNISFQMELDV O DSETKNAVFLIL O VLEFMDIASVLD5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd G