Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA codons can be recognized by the TRNA anticodon ICG. (note: answer all possibilities) DA UGA OB.CGU OC CGA ODUGC DE CGC QUESTION 3 Anti-codon is defined as "transfer RNAS base-pair with MRNA codons at a three-base sequence on the tRNA". O True O False
Q: 1. The group of Leonor and Junior conducted an experiment about the fragmentation of planaria.…
A: In this, the given paragraph includes the experimental process and the observations of…
Q: how can your knowledge of the different locations and drainage of the Lymphatics of the head and…
A: Answer
Q: Stimulation of D1 Medium Spiny Neurons in the Striatum causes of the Globus Pallidus and subsequent…
A: The basal ganglia are involved in action selection. It is a proven fact that a direct pathway leads…
Q: A beneficial dominant mutation is expected to take fewer generations to reach high frequency than a…
A: There are few important points: A population genetics is the study of changes in the frequencies of…
Q: In terms of feeding strategies, do you think a large priapulid is more efficient than a small one?…
A: Priapulid are referred to as penis worms because of their structural morphology similar to the male…
Q: Referring to Figure 17-26, draw the product if breaks occurred within genes A and B
A: An inversion is a chromosomal rearrangement where a portion of a chromosome is flipped end-to-end.…
Q: Which of the following is true of TATA boxes? I. they are found within the core sequence of a gene…
A: * TATA box is a part of DNA sequence where genetic sequence will be read and decoded. *It is one…
Q: Glucocorticoids are __________ hormones secreted by __________ glands. Multiple Choice peptide;…
A: Glucocortioids are the hormones that is used for the treatment of the inflammation, autoimmune…
Q: Question 33 RNA polymerase II: A is located in the nucleoplasm and transcribes the protein-encoding…
A: Transcription is the process which is required for formation of mRNA from template strand of DNA.
Q: Which of the following is/are the contents of the dorsal body cavity? A. heart and lungs B. brain…
A: Introduction - The cranial cavity, which houses the brain, and the spinal cavity, which houses the…
Q: Similar genes in two separate lineages that are the result of a "lineage splitting event" A at some…
A: Species is defined as the group of individuals that can mate together.
Q: The mechanism of activation of eukaryotic genes involves addition and removal of phosphate residues…
A: The eukaryotic system has a general trend of activating anything by phosphorylation and vice versa.…
Q: humectants as food additives.
A: Food additives Food additives are substances that when added to food increase their flavours, taste,…
Q: Which type of molecule binds at the core promoter sites in association with RNA polymerase? A…
A: RNA polymerase can attach to the polymer by only one method. This method involves binding of Basal.…
Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…
A: Bone is a mineralized connective tissue . The matrix of bone is made up of calcium and phosphate…
Q: This figure can be used to represent the sequence of events leading to the evolution of dark-furred…
A: Evolution is the change in the characteristics of a species over several generations and relies on…
Q: Recent - English (en) - 23/4/2022 l a 12:00 e ial الاجابة تكون على شكل نص كتابي فقط و يمنع تحميل…
A: A BUN test is a blood test most commonly used to evaluate kidney function. It's often done along…
Q: What is psedupodia
A: Introduction :- A pseudopodium is a transient protrusion of a eukaryotic cell's cytoplasm.
Q: Question 47 The proofreading of DNA is essential for faithful replication. A) True B) False
A: Proof reading of DNA is essential for maintaining a homogenous DNA across multiple cycles of…
Q: Cuvier's idea of catastrophe related to asteroid collisions understanding that geological change…
A: Theory of catastrophes by George's Cuvier According to this theory, fossil show that animal and…
Q: Which of the evolutionary processes discussed in the material presented can introduce genetic…
A: Natural selection: it states that only those organisms who are fit according to the environmental…
Q: Who is Wisdom and what record does she hold? 2. What are salt glands and why do seabirds have them?…
A: 1. I couldn't understand it properly. Probably this will help you... Wisdom is a literary…
Q: A 3-point test cross produces the following numbers of offspring: The yellow cells are the…
A: The three point test cross data is given in the question. The three genes are involved in a three…
Q: Choose the letter that DOES NOT BELONG ON THE LIST. A. biodiesel B. crude oil C. coal D. natural…
A: The source of energy refers to fuels available on the earth. There are deposits of different fuels…
Q: Marcus is admitted to the hospital for a bone marrow stem cell transplant from his brother, What…
A: Introduction They are of various types of stem cells.Embryonic stem cells - They are isolated from…
Q: Narcolepsy is thought to occur from dysfunction of neurons located in the hypothalamus hippocampus…
A: Introduction - Narcolepsy is a persistent sleep condition marked by excessive daytime sleepiness and…
Q: The lack of a cure or effective treatment for malaria can be attributed to. The expected return on…
A: Answer :-(D) The lack of cure or effective treatment for malaria can be attributed to malaria is no…
Q: We are not usually consciously aware of our blood glucose levels because: O Information about blood…
A: * Nervous system divided into two main parts that is central nervous system (CNS) peripheral…
Q: Natural selection favored dark-colored fur in the rock pocket mouse. The selective force on the…
A: Natural selection It is a natural biological process where organisms adapt and change there…
Q: explain what is similar and what is different from the bacteriophages of covid-19
A: Bacteriophages or phages are the viruses that infect and kill bacteria. Bacteriophages consist of a…
Q: Define disinfection. Compare/contrast it with sterilization, antisepsis and bacteriostasis.
A: Sterilization, disinfectant, antisepsis and bacteriostatic all terms are related to halt the growth…
Q: 1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 1.0 0.9 0.8 A? (aa) p2 (AA) Frequency of heterozygotes is…
A:
Q: Which statement about energy flow in ecosystems is accurate? A.Energy flow reaches an equilibrium…
A: Environmental science is one of the sciences that we must learn that every living thing on this…
Q: Which of the following are examples of species interactions where one species benefits and one…
A: Parasitism is the relation in which one species is benefitted and the other is harmed. In…
Q: The process of __________ usually involves modification and selectivity
A: Introduction Breeding is a type of sexual reproduction that results in formation of offspring, which…
Q: In goats, the gene for coat color is on an autosome and light brown color is dominant to black. A…
A: Let the gene determining the same be B/b So light brown male is BB Dark brown female is bb BBX bb Bb…
Q: What is the relationship between the severity of symptoms and the size of the chromosome involved in…
A: More the size of the chromosomes involved in the trisomy, more will be the severity of symptoms.…
Q: In microscopy, what could be the possible reason why we cannot completely resolve the specimen under…
A: A microscope is a lab instrument used to examine the objects that are too small to be seen by the…
Q: Enzymes that acetylate the e-amino group of lysine in the histone tails are called and are involved…
A: Histone is made up of majority lysine and arginine (positive amino acids) as a result negative…
Q: DIRECTIONS: Examine the illustrations of the marine organisms shown below whose fossils make up part…
A: * Darwin said that the Fossils records provide evidence that the living organisms evolved from many…
Q: Which of the following would result in no movement (i.e. no activation of the mo cortex)?…
A:
Q: On the planet of Caracas, in the Stellar Solorais KaChunka Galaxy, there is a population of…
A: Given: The phenotype of interest is Peanutus01. There are two alleles for the autosomal gene…
Q: true or false: a cell spends most of its life in G1 of interphase building proteins and making ATP.…
A: Introduction Cell is the smallest basic unit of life that can live on its own, is responsible for…
Q: In all types of bacteria, there are DNA and RNA. * True O False
A: This is true...
Q: Explain why the following statement are incorrect.. rewrite them to make it correct 1) evolution is…
A: Evolution can be described as the gradual and continuous change in organisms. It is the process by…
Q: Why is the base pairing in D N A important? How does mRNA production in eukaryotes differ from the…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide sequences which curl around…
Q: 7. RSV is a and as generated during times of biotic and m. abiotic stress in plants. 8. RSV produced…
A: Solution :- Stage 1 Here I examine about RSV and their job in plants as indicated by fill in the…
Q: true or false: meiosis takes place in body cells called somatic cells.
A: Meiosis is a double division which occurs in a diploid cell and gives rise to four haploid cells…
Q: Killiani Fisher Synthesis
A:
Q: According to the recent malaria report of the Department of Health, Disease and Prevention Bureau…
A: The malarial parasite passes its life cycle I'm two different host's. The man is the intermediate…
6
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
- Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonGiven the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
- c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acida) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.