2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged red fibers of skeletal muscle cells and myoclinic epilepsy in affected individuals. People with this disorder have a mutation in a mitochondrial gene for a tRNA, specfically that for lysine. Why are affected individuals always heteroplasmic?
Q: Yet another class of suppressor mutations not described in the chapter are mutations in tRNA…
A: Frameshift mutations result from the "insertion or deletion" of nucleotides within the coding…
Q: 1. Peroxisomes are organelles surrounded by a single membrane. Soluble proteins that reside within…
A: Answer a) If we do mutation at the c terminus skl tripeptide signal sequence then this protein will…
Q: Explain whether the specificity of lysine incorporation by lysyl-tRNA synthetase depends on tRNA or…
A: As per the honor code, we only answer one question at a time. Therefore, we are answering the first…
Q: Name the GREEN structure of the tRNA Variable loop D-loop Anticodon loop Pseudouridine loop
A: According to the messenger RNA (mRNA) nucleotide sequence, transfer RNAs (tRNAs), also known as…
Q: The peptidyltransferase reaction begins with the hydrolysis or breaking of the bond between the…
A: The translation is the process in which the genetic code carried by mRNA is decoded to produce the…
Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…
A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…
Q: ACTIVITY 3. POINT MUTATION Directions: Translate the genes in the TRNA into amino acids. Then,…
A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…
Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…
A: Myoclonic epilepsy:It is related to a family of epilepsies which are present along with myoclonus.…
Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…
A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…
Q: Explain post-translational modification of proteins in general with the types of reactions. Provide…
A: Ans:--PMT's are enzymatic , covalent chemical modification of protiens that typically occur ofter…
Q: In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These…
A: Codon is located on mRNA while anticodon is on tRNA. Anticodons specifically identifies and pair to…
Q: All of the following occur when the amino acids of two tRNA molecules are joined, except. a. The…
A: DNA replication, transcription, and translation are the molecular processes that are responsible for…
Q: In the: Inhibition of splicing by ribozymes Explain: (a) What is the process affected? (b) What is…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…
Q: A mutation that changes an alanine to a leucine in the nucleus of a protein leads to a less active…
A: Introduction: Each organism's DNA sequence is unique. Its base-pairs sequence can change from time…
Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…
A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…
Q: The unfolding of a tRNA molecule has been measured as a function of temperature (data below). Use…
A: Free energy of Gibb's free energy indicates the portion of the total energy of a system that is…
Q: A point mutation occurs in the middle of the coding sequence for agene. Which types of…
A: Mutation is the process of abrupt changes in the nucleotide sequence or gene in the DNA. Mutation…
Q: Which of the following is not true? There are two major classes of aminoacyl-tRNA synthetases…
A: Central dogma includes three main processes Replication, Transcription, and Translation.…
Q: How does the protein encoded by the KanR gene inactivate kanamycin? O by rapidly pumping the…
A: Kanamycin inactivation :-
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Ribosomes are the protein synthesizing machinery present in a cell. A protein is synthesized during…
Q: N' C' = Polypeptide X d a b = SRP 5'- = translocator e Which region(s) of polypeptide X would bind…
A: Ribosomes refer to the site where the protein synthesis takes place. It comprises rRNA and protein.…
Q: At least one nonsense suppressing tRNA is knownthat can suppress more than one type of…
A: tRNA is a transfer ribonucleic acid. It is a type of RNA which decodes the messenger RNA and form a…
Q: iii. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…
A: Promoter sequence is present in the DNA at the upstream of regulatory gene.
Q: After being irradiated, the gene coding for the E site is mutated, causing the E site to have a…
A: Mutations are the random changes in the DNA of organisms.
Q: The aminoacyl- RNA synthetase enzymes are responsible for: O A. matching each TRNA with the…
A: Aminoacyl-tRNA synthetases enzymes is used in protein biosynthesis during translation process.…
Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…
A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…
Q: You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a…
A: In case of third experiment, both SRP (signal recognition particle) and endoplasmic reticulum…
Q: The peptide bond formation is catalyzed by a. the aminoacyl tRNA synthetase b. tRNA c. the small…
A: Translation is a method or process by which the message on the messenger RNA is converted into a…
Q: The charging of a tRNA with an amino acid can be represented by the following equation:amino acid +…
A: Translation is a biochemical phenomena in which mRNA molecule gets translated to proteins. Charging…
Q: I only need letter D and E
A: There is a group of three bases in an mRNA. This group of three bases comprises a codon. Each codon…
Q: In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give…
A: 1 a) No, there wont be any problem in expressing the two genes. But in bacteria, most of the gene…
Q: Discuss how cholesterol is transported between tissues in plasma lipoproteins.
A: Plasma lipoproteins (LPs) are soluble aggregates of lipids and proteins which deliver hydrophobic,…
Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?
A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…
Q: Renata enzymatically conjugates a l"C-labeled cysteine to a transfer RNA (TRNA), with a UGU…
A: Transcription involves the copying of information from a strand of DNA into a new molecule of…
Q: The 3 sites that bind tRNAs on a ribosome are on the A, P and E sites. How many sites can tRNA(s) be…
A: Translation is the formation of protein from mRNA. It occurs in cytoplasm of cell.
Q: How many different aminoacyl-tRNA synthetases are there in a cell?
A: Each cell have amino acid and it is different for each cell.
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…
Q: 5' - ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the…
A: The mRNA is produced from the template strand that is oriented in 3' to 5' direction and the newly…
Q: in a clever experiment performed in 1962, a cysteine already attached to its tRNA was chemically…
A: The tiny RNA molecule transfer RNA (abbreviated tRNA) is essential for protein synthesis. Transfer…
Q: In the early days of research on protein synthesis, some scientists observed that their most highly…
A: Some scientists recognized that most highly purified ribosome preparations containing single…
Q: The first aminoacyl-TRNA that binds to the ribosome: a. is a special fMet-tRNAet in prokaryotes. b.…
A: mRNA transcribed from nucleic acid will be translated into peptide sequence by ribosome. Ribosome…
Q: 190. What site in the large ribosomal unit will the first anticodon/initiator tRNA enter? A.P site…
A: Introduction :- The ribosome is a complex molecule made up of ribosomal RNA molecules and proteins…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Central dogma of life involves gene expression, or the flow of genetic information from genes to…
Q: 1d) What amino acid would a tRNA with the anticodon 5'AGG³' carry?
A: The amino acids are the fundamental structural unit of proteins. There are 20 amino acids that code…
2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged red fibers of skeletal muscle cells and myoclinic epilepsy in affected individuals. People with this disorder have a mutation in a mitochondrial gene for a tRNA, specfically that for lysine. Why are affected individuals always heteroplasmic?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner and also induce conformational changes in the DNA. Describe the purpose of thses two modes of interaction with the DNA. 2. Draw the structures of the amino acid side chains that correspond to the following histone modification: a) acetylation of lysine; b) phosphorylation of serine; c) phosphorylation of histidine. How do thses modifications change the character of their respective side chain?Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…Mutations that introduce stop codons cause a number of genetic diseases. For example, from 2% to 5% of the people who have cystic fibrosis possess a mutation that causes a premature stop codon in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). This premature stop codon produces a truncated form of CFTRthat is nonfunctional and results in the symptoms of cystic fibrosis . One possible way to treat people with genetic diseases caused by these types of mutations is to trick the ribosome into reading through the stop codon, inserting an amino acid in its place. Although the protein produced may have one altered amino acid, it is more likely to be at least partly functional than is the truncated protein produced when the ribosome stalls at the stop codon. Indeed, geneticists have conducted clinical trials of a drug called PTC124 on people with cystic fibrosis. This drug interferes with the ribosome’s ability to correctly read stop codons . On the basis of…
- 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.1. (a) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to sup- press synthesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix - reverse turn - helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein. A diagram of the trp repressor dimer is also shown. Trp Prl Trp Prl 80 -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly-Ile- -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr-Val- trp helix 5 70 trp helix 4 Prl helix 80 Prl helix Ala-Thr-Ile-Thr-Arg-Gly-Ser-Asn-Ser-Leu-Lys-Ala-Ala- Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- reverse turn 90 Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dissociable groups (assume pH 7). Indicate the charge of both residues for each such pair. (b) Circle the pair of residues for which the electrostatic charge due to…1d) What amino acid would a tRNA with the anticodon 5'AGG³' carry?
- (c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helixMutations that introduce stop codons cause a number of genetic diseases. For example, from 2% to 5% of the people who have cystic fibrosis possess a mutation that causes a premature stop codon in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). This premature stop codon produces a truncated form of CFTR that is nonfunctional and results in the symptoms of cystic fibrosis. One possible way to treat people with genetic diseases caused by these types of mutations is to trick the ribosome into reading through the stop codon, inserting an amino acid in its place. Although the protein produced may have one altered amino acid, it is more likely to be at least partly functional than is the truncated protein produced when the ribosome stalls at the stop codon. Indeed, geneticists have conducted clinical trials of a drug called PTC124 on people with cystic fibrosis. This drug interferes with the ribosome’s ability to correctly read stop codons (C. Ainsworth.…If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-The charging of a tRNA with an amino acid can be represented by the following equation:amino acid + tRNA + ATP → aminoacyl-tRNA + AMP + PPI where PPI is pyrophosphate (see figure 3–40). in the aminoacyl-tRNA, the amino acid and tRNA are linked with a high-energy covalent bond; a large portion of the energy derived from the hydrolysis of ATP is thus stored in this bond and is available to drive peptide bond formation at the later stages of protein synthesis. the free-energy change of the charging reaction shown in the equation is close to zero and therefore would not be expected to favor attachment of the amino acid to tRNA. Can you suggest a further step that could drive the reaction to completion?14. Which mutation would be more harmful to a cell? For each predict the outcome of each mutation and explain one is worse than the other A) A mutation in the anticodon of Ala-tRNA from IGC to IGG OR a mutation in the alanyl tRNA synthase such that it adds either Ala or Ile to the appropriate tRNA? B) A mutation in bases 11 and 24 of the Ser-tRNA (both important recognition elements for serinyl tRNA synthase OR a mutation in the proofreading site of serinyl tRNA that inactivates proofreading