1. What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?
Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…
A: Hi, Thanks For Your Question. Answer : Let's Learn Some Basic Concepts First: Transcription : It Is…
Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 1. What are the differences between DNA and RNA? 2. Which process involves copying of DNA…
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…
Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…
A: The process of formation of messenger RNA with the help of template strand of DNA is called…
Q: What mRNA is transcribed from each DNA sequen а. 5'-GTTCTАС-3' 3'- -5' b. 5'-ATTTGAAA-3' 3'- -5' с.…
A: The method of constructing an RNA copy of a genetic sequence is known as transcription. That copy,…
Q: What is the central dogma? What are the compounds involved in this process? (Keywords: transcription…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…
Q: 1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U…
A: Only proline amino acid form as second codon is stop codon here
Q: 1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by…
A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…
Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…
A:
Q: 20. Fill in this table with the effects that this mutation would have on mRNA and protein sequence…
A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: The process of synthesizing RNA from the genetic information encoded by DNA is called Transcription…
Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…
A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…
Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…
A: DNA to mRNA is transcription and mRNA to protein is translation.
Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…
A: Gene expression is the process by which the instructions in the DNA is converted into a functional…
Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…
A: Codon It is the three consecutive sequence of a mRNA that code for amino acid.
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: The RNA is produced from the template strand of DNA by the transcription process that occurs within…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 1. What are the amino acids translated from the resulting mRNA?
A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…
Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…
A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh
Q: 1. What are the types and major functions for each type of RNA?
A: NOTE: Since you have asked multiple question, we will solve the first question for you. If you…
Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…
A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: Build" the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly, letter by…
A: The process of RNA synthesis with the help of template strand of DNA is called transcription. It is…
Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…
A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.
Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…
A: DNA acts as genetic material in most organisms. DNA gets transcribed into mRNA by an RNA polymerase…
Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…
A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…
Q: Which of the following statements about mRNA is correct? a. Eukaryotic mRNA is generally…
A: Introduction:- Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…
Q: 8.) Answer the following questions regarding the following DNA sequence.…
A: During transcription RNA synthesis occurs over DNA and translation or protein synthesis occurs over…
Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?
A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…
Q: 1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it…
A: # According to our guideline we can answer maximum three sub parts of a questions. So, upload the…
Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…
A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…
Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…
A: The central dogma of molecular biology involves the processes of transcription and translation that…
Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands…
A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…
Q: B- TRANSCRIPTION 1. Use the DNA code provided to copy an mRNA message. (DNA) a. TAC GGA CAT (DNA) b.…
A: The central dogma explains that the information from the DNA will be passed in a sequence fashion…
Q: 3. Finally, directly below the mRNA sequence that you wrote for #2, write the amino acid sequence of…
A: The DNA sequence given in the question would act as a coding stand for the synthesis of mRNA. The…
Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…
A:
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The gene is expressed from DNA into protein by Central Dogma. The transcription and translation…
Q: 1. Using the DNA provided transcribe DNA into mRNA. 2. Use the mRNA strand you created and break it…
A: DNA is the main genetic material present in most organisms and stores all the genetic information of…
Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…
A: The information from the DNA is transferred to RNA by transcription. The information present in the…
Q: 1. how is information from the DNA passes on from one cell to another? 2. How does the structure of…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…
A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…
Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…
A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…
Q: 4. Draw and label the Transcription process. 5. Draw and label the Translation process.
A: Transcription is the process in which RNA is made from DNA, while translation is the process in…
Q: The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence…
A: Given mRNA sequence is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' As we know that, Bases in DNA is…
Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…
A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…
Q: 2. įmagine that you and your colleagues are working in a lab to develop a protein synthesis system…
A: The prokaryotes have a polycistronic mRNA while the eukaryotes have a monocistronic mRNA. The mRNA…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Here i discuss about the coding strand, antisense strand of DNA, their transcribed products as well…
Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…
A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…
1. What mRNA sequence is synthesized from a section of DNA that is
3’-TTGACCT-5’?
2. In what direction does a polymerase move when synthesizing a strand of mRNA?
3. Define transcription and translation. Which process occurs first to make protein from DNA?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are the tRNA anticodons of the mRNA codons from item 1? 3. What is the complementary DNA strand of the mRNA strand from item no 1? 4. The DNA strand from item 3 undergoes replication. What will be its complementary DNA strand?
- 1. Define transcription and translation. Which process occurs first to make protein from DNA? 2. In what direction does a polymerase move when synthesizing a strand of mRNA?4.) what is the amino acid chain that your answer in item 2 will dictate? Question in Item 2: The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? Answer : The mRNA complementary strand from this complementary strand obtained from item 1 should be:AAGUUUCGCCCCGGG. 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1. Question in item 1 : if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? Answer : According to complementary base pairing rules, A is complementary to T and G is complementary to C. Hence the complementary DNA strand should be:TTCAAAGCGGGGCCC11. The segment of DNA below contains three exons and two introns. The length of each section is as follows: Exon 1: 90 base pairs Exon 2: 110 base pairs Exon 3: 70 base pairs Intron 1: 180 base pairs Intron 2: 120 base pairs Initiation Site Intron 1 Promoter Exon 1 Intron2 Exon 3 Termination Site A. How long will the coding region of the processed mRNA transcript be? (Remember that stop codons are indeed transcribed into mRNA.) B. How many amino acids will be included in the translated protein? (Careful!) X PolyA site Exon 2
- DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
- 6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.4. How is replication different from transcription in terms of product? 5. What do you call each triplet code made up of three linearly arranged nucleotides in the mRNA? 6. What is the complement of the mRNA triplet code in the tRNA? 7. In what way is tRNA different from mRNA? 8. In what ways are RNA and DNA similar? 9, In what ways are they different?