Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences: 5' CCTATGCAGTGGCCATATTCCAAAGCATAGC 3' 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA? 3. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 4. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for a protein in this mRNA? c. what stop codon is present in this mRNA?

Q: A diet deficient in folic acid is highly unlikely since folic acid is found in almost all foods.…

A: A diet deficient in folic acid can have serious health consequences. Folic acid, also known as…

Q: PLEASE ANSWER the questions correlty and please answer all the questions with what it regards in…

A: Nursing is a health care profession. The nurse plays an important role in taking care of the…

Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…

A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…

Q: Which one of the following supplements has the greatest scientific support Folic acid to reduce the…

A: Supplements can play an important role in maintaining good health and preventing certain health…

Q: ISBAR I made? Please indicate my mistakes and how should I do it instead, thank you so much.

A: ISBAR stands for  Introduction, Situation, Background, Assessment and Recommendation. 1. In…

Q: Gioe beovres die/ge drde or rlaun HG- tikad Alaa ktat Tiwan prdar cal lele steat i Aart atoe…

A: Since we only answer one question at a time, we’ll answer the first one (flow chart). Please…

Q: 1. Compare and contrast probable lack of anonymity in rural vs. urban settings. 2. What are at least…

A: The dynamics of healthcare delivery take on a particular dimension when a primary care clinic…

Q: dentify the disaccharide in the list below. Lactose Glucose Dextrose Galactose Fructose 1.b)In…

A: Introduction There are 4 types of biomolecules present in our body, protein, carbohydrate, lipids…

Q: PRODUCTS, IS A SOURCE OF PECTIN SUBSTANCES 1. milk 2. apple, plum 3. bakery products and cereals 4.…

A: Pectin is a polysaccharide present mainly in the cell walls and non woody parts of terrestrial…

Q: MECHANICAL METHOD OF WATER TREATMENT AT THE WATER- WIRED STATION 1. filtering 2. defending 3.…

A: Mechanical filtration system in water treatment plant uses different units to filter out suspended…

Q: flew from Montreal to Ottawa to speak with Prime Minister Trudeau recently flew with President Biden…

A: The red-vented bulbul  is a member of the Bulbul amily of Passerines. It has a short crest  and a…

Q: R 2 3 5 01 6 7 8 Dorsal cavities Ventral cavities

A: The human body is organized into various cavities, each serving distinct functionsCranial…

Q: MICROELEMENT COMING INTO THE BODY WITH WATER 1. iodine 2. bromine 3. sodium 4. Fluorine 5. silver

A: Water hydrates mucosal membranes in the respiratory and gastrointestinal systems and is required for…

Q: When protein is converted in the body to amino acids, what is the role of water? Only beef proteins…

A: Proteins are essential nutrients that the body needs to function properly. They are important for…

Q: DIVIDING WORDS EXERCISE Separate these words into their component parts (prefix, combining form,…

A: Medical terminologies help in easier understanding of the word. It gives the origin, the components,…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: The Function of skeletal system all except support body O protection of internal organ movement O…

A: Introduction :- The bones make up your skeletal system, which provides support for the rest of your…

Q: ONE-TIME MAXIMUM ALLOWABLE CONCENTRATION FOR ATMOSPHERIC AIR PREVENTS DEVELOPMENT 1. severe irritant…

A: The Maximum Allowable Concentration (MAC) is a set of guidelines for safe exposure levels to a…

Q: ISBAR

A: ISBAR stands for introduction,  situation, background, assessment and recommendation.

Q: Cancer is classified with the type 1 of DM True False

A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…

Q: Please pray for my mom he is still coughing. Oh Don't forget to also prescribe natural medicine for…

A: Here is a method for resolving the question: Methodology for Addressing the Problem: 1. Comprehend…

Q: 21 PS 2F ZS E 22

A: This picture is of Cell division (Anaphase)  Mitosis is a type of cell division in which a cell…

Q: I need help to Label the structures.

A: Tonsils are part of the lymphoid system. They are the lymph nodes that are located at the back of…

Q: Help please let me answer

A: We know that Lymphatic vessels are a network of capillaries and a huge network of tubes that move…

Q: What is the best way to emotionally support a client with a life altering illness

A: We know that The disease conditions are so harmful that those can be fatal and arises…

Q: DIVIDING WORDS EXERCISE Separate these words into their component parts (prefix, combining form,…

A: Since you have posted multiple questions, we will answer the first question for you. If you need any…

Q: A prenatal multivitamin supplement is more likely to restrict the amount of which vitamin? Niacin…

A: Vitamins and minerals are essential nutrients that the body needs to function properly. Vitamins are…

Q: Part A Each person should post a question about social or sexual health. Questions can be very…

A: Social and sexual health play crucial roles in our overall wellbeing.Unfortunately, many individuals…

Q: PLEASE PLEASE DON'T CANCEL I WILL UPVOTE LETTER W please choose statements/concepts that relate to…

A: Introduction: The human body comprises various organ systems. When it comes to anatomy, it's all…

Q: Sarcomere lies between O two I band O two Z line O M lineand Z line O two M line *

A: Muscular system is a part of body system which is involved in regular contraction as well relaxation…

Q: Part IV – Late Stage Complications After Jamie's visit with the rheumatologist, she was treated with…

A: Cardiac indicators or cardiac enzymes or cardiac biomarkers are myoglobin, troponin, creatine…

Q: What do vaccines introduce into the body? short chain fatty acids antibodies lymphocytes phagocytes…

A: vaccines are biological preparations that help to stimulate an individual's immune system to produce…

Q: Quantal release can occur spontaneously O True O False

A: Quantal release refers to the neurotransmitter released from the vesicles. This is mainly used for…

Q: 81. Uonsən Match the device with its type. Submitted Answers Prompts Mouse Input device Printer…

A: Your answer to all the subparts is correct. The mouse is an input device. The printer is an output…

Q: The patient will more than be placed on another medicallon Can you anything that you could do as an…

A: *Medical assistants are healthcare professionals that assist doctors in clinics and offices. *They…

Q: what are some misconceptions about sex?

A: Reproduction can be defined as a biological process that produces new individual organisms or…

Q: Please I need help understand which it is

A: Hormones are chemical compounds that are usually released by endocrine glands of the body and have a…

Q: s there/Are there Violation or non-violation of Intention/End Circumstances Judgement…

A: bioethical consideration 1 2 3 4 5 6   5 NO BENEFICENCE GOOD GOOD INCREASE THE GOOD MORALLY…

Q: In the article "Playing the Odds", Ellen, a woman in her fifties, had symptoms of a stroke. When…

A: In this question, we are given with an article which describes the conditions of a lady named Ellen…

Q: 3) The phase shaded in yellow according to the diagram shown in the figure coincides with: +20 m The…

A: Cardiac action potential is change in the membrane potential across the membrane of heart cells.…

Q: General charecters and Lap diagnosis of gooze parvo-virus ?

A: Introduction  Viruses are microscopic infectious agents that can infect and multiply within the…

Q: .Choose the correct sentence I have get a big present. O The leadership is a big responsibility Does…

A: Confidence and commitment are the qualities of a leader. Leadership is the state of being in charge.…

Q: FOODS RICH IN VITAMIN «K» 1. fish 2. carrots,tomatoes 3. meat 4. milk

A: Introduction Vitamin K, the generic name for a group of substances with the chemical formula…

Q: hello, I am in my 20s, male and I wanted to ask you guys what are the high-risk conditions that I…

A: A male at the age of 20 can face following  high -risk conditions:- 1) DRINKING ALCOHOL AND…

Q: Judgement there/Are there principle/principles violated with the sit- Violation or non-violation of…

A: Ethics or bioethics It associated with the Behavioural standards in the healthcare setting.…

Q: I need help naming these tissues

A: Histology is the study of tissues and its structures in detail. It is a part of anatomy and…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.