Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences: 5' CCTATGCAGTGGCCATATTCCAAAGCATAGC 3' 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA? 3. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 4. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for a protein in this mRNA? c. what stop codon is present in this mRNA?

Q: A diet deficient in folic acid is highly unlikely since folic acid is found in almost all foods.…

A: A diet deficient in folic acid can have serious health consequences. Folic acid, also known as…

Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…

A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…

Q: Which one of the following supplements has the greatest scientific support Folic acid to reduce the…

A: Supplements can play an important role in maintaining good health and preventing certain health…

Q: ISBAR I made? Please indicate my mistakes and how should I do it instead, thank you so much.

A: ISBAR stands for  Introduction, Situation, Background, Assessment and Recommendation. 1. In…

Q: Gioe beovres die/ge drde or rlaun HG- tikad Alaa ktat Tiwan prdar cal lele steat i Aart atoe…

A: Since we only answer one question at a time, we’ll answer the first one (flow chart). Please…

Q: ASE ANSWER the questions correlty and please answer all the questions with what it regards in saying…

A: Introduction: Vitamins are necessary nutrients that must be consumed in moderation in order to…

Q: 1. Compare and contrast probable lack of anonymity in rural vs. urban settings. 2. What are at least…

A: The dynamics of healthcare delivery take on a particular dimension when a primary care clinic…

Q: dentify the disaccharide in the list below. Lactose Glucose Dextrose Galactose Fructose 1.b)In…

A: Introduction There are 4 types of biomolecules present in our body, protein, carbohydrate, lipids…

Q: PRODUCTS, IS A SOURCE OF PECTIN SUBSTANCES 1. milk 2. apple, plum 3. bakery products and cereals 4.…

A: Pectin is a polysaccharide present mainly in the cell walls and non woody parts of terrestrial…

Q: flew from Montreal to Ottawa to speak with Prime Minister Trudeau recently flew with President Biden…

A: The red-vented bulbul  is a member of the Bulbul amily of Passerines. It has a short crest  and a…

Q: R 2 3 5 01 6 7 8 Dorsal cavities Ventral cavities

A: The human body is organized into various cavities, each serving distinct functionsCranial…

Q: MICROELEMENT COMING INTO THE BODY WITH WATER 1. iodine 2. bromine 3. sodium 4. Fluorine 5. silver

A: Water hydrates mucosal membranes in the respiratory and gastrointestinal systems and is required for…

Q: 1. Explain the difference between a WBC count and a differentialcount in terms of what information…

A: Hello, as your question has many parts, we will only answer the first three parts for you and if you…

Q: When protein is converted in the body to amino acids, what is the role of water? Only beef proteins…

A: Proteins are essential nutrients that the body needs to function properly. They are important for…

Q: SUPERFLUOUS RECEIPT OF CHLORIDES WITH WATER RESULTS 1. urolithiasis 2. the formation of…

A: It's important since sodium chloride regulates urine calcium and, as a result, the danger of kidney…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: The Function of skeletal system all except support body O protection of internal organ movement O…

A: Introduction :- The bones make up your skeletal system, which provides support for the rest of your…

Q: ONE-TIME MAXIMUM ALLOWABLE CONCENTRATION FOR ATMOSPHERIC AIR PREVENTS DEVELOPMENT 1. severe irritant…

A: The Maximum Allowable Concentration (MAC) is a set of guidelines for safe exposure levels to a…

Q: Cancer is classified with the type 1 of DM True False

A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…

Q: Please pray for my mom he is still coughing. Oh Don't forget to also prescribe natural medicine for…

A: Here is a method for resolving the question: Methodology for Addressing the Problem: 1. Comprehend…

Q: WHICH FACTOR DOES NOT APPLY TO HARMFUL AND DANGEROUS PRODUCTION FACTORS 1. physical 2. chemical 3.…

A: Factors for production can be biological, chemical, mechanical etc.

Q: I need help to Label the structures.

A: Tonsils are part of the lymphoid system. They are the lymph nodes that are located at the back of…

Q: What is the best way to emotionally support a client with a life altering illness

A: We know that The disease conditions are so harmful that those can be fatal and arises…

Q: DIVIDING WORDS EXERCISE Separate these words into their component parts (prefix, combining form,…

A: Since you have posted multiple questions, we will answer the first question for you. If you need any…

Q: A prenatal multivitamin supplement is more likely to restrict the amount of which vitamin? Niacin…

A: Vitamins and minerals are essential nutrients that the body needs to function properly. Vitamins are…

Q: Part A Each person should post a question about social or sexual health. Questions can be very…

A: Social and sexual health play crucial roles in our overall wellbeing.Unfortunately, many individuals…

Q: the aduwantage W hat of Jean Watson Aurgina Theory are on Pahrent A Family ?

A: Nursing care is the field of clinical practice of administration of drug ,patient counselling and…

Q: Pomegranate juice contains natural aromatase inhibitors. is high in beta carotene. has been shown in…

A: Pome granate juice is considered a very healthy juice owing to its ingredients. It consists of…

Q: Discuss the physiological mechanisms that regulate

A: The average pressure in the arteries of the patient during one cardiac cycle is known as mean…

Q: Part IV – Late Stage Complications After Jamie's visit with the rheumatologist, she was treated with…

A: Cardiac indicators or cardiac enzymes or cardiac biomarkers are myoglobin, troponin, creatine…

Q: What do vaccines introduce into the body? short chain fatty acids antibodies lymphocytes phagocytes…

A: vaccines are biological preparations that help to stimulate an individual's immune system to produce…

Q: Chicken feathers have long been discarded by the poultry industry until recently. What is now being…

A: Enzymes are proteins that act as catalysts in biochemical reactions. They speed up the rate of a…

Q: 1.a)Which one of the following diseases is caused by an iodine deficiency? pellagra goiter night…

A: Iodine deficiency is a condition in which the body does not have enough iodine to produce thyroid…

Q: The patient will more than be placed on another medicallon Can you anything that you could do as an…

A: *Medical assistants are healthcare professionals that assist doctors in clinics and offices. *They…

Q: what are some misconceptions about sex?

A: Reproduction can be defined as a biological process that produces new individual organisms or…

Q: s there/Are there Violation or non-violation of Intention/End Circumstances Judgement…

A: bioethical consideration 1 2 3 4 5 6   5 NO BENEFICENCE GOOD GOOD INCREASE THE GOOD MORALLY…

Q: 3) The phase shaded in yellow according to the diagram shown in the figure coincides with: +20 m The…

A: Cardiac action potential is change in the membrane potential across the membrane of heart cells.…

Q: .Choose the correct sentence I have get a big present. O The leadership is a big responsibility Does…

A: Confidence and commitment are the qualities of a leader. Leadership is the state of being in charge.…

Q: hello, I am in my 20s, male and I wanted to ask you guys what are the high-risk conditions that I…

A: A male at the age of 20 can face following  high -risk conditions:- 1) DRINKING ALCOHOL AND…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.