4. Draw and label the Transcription process. 5. Draw and label the Translation process.

Based on your understanding of transcription, place the following events in the correct order. 1. A base pairs with U, and G with C 2. RNA released 3. RNA polymerase binds 4. transcription bubble 5. DNA polymerase grows new chain 6. A base pairs with T, and C with G 7. Promoter is reached O 3,4, 7, 5, 6, 1 O 5, 6, 3, 1, 2 O 7,3, 4, 6, 1, 2 O 3, 7, 4, 1, 2 O 5, 2, 4, 7, 1, 3

2.  List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

1. Describe several different DNA repair mechanisms. Which ones contribute to mutations?   2. What is the difference between an ortholog and a paralog

6.  explain what coupled transcription-translation is, and why it occurs in prokaryotes but not eukaryotes

3. Differentiate between factors and processes involved in transcription: Recognition of this DNA sequence is [Choose] required for transcription to initiate:. [ Choose ] PROMOTER Occurs when the ribosome reaches a RNA POLYMERASE stop codon on the MRNA TERMINATION INITIATION SITE ENHANCERS The main enzyme responsible for transcribing DNA into RNA is ELONGATION Will increase the efficiency of gene [Choose] expression, but are not essential for transcription. RNA polymerase "walks" along the template strand, adding a [Choose ] matching (complementary) RNA nucleotide to each existing ncleotide. The section of DNA from which the [Choose ) very first 5" RNA nucleotide is transcribed Question 4 1 pts hp 近

1. What happens during transcription? Possible sentence frame: Transcription is the process in which the information from converted into This happens by is