1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…
A: The protein synthesis occurs in cytoplasm by the process of translation.
Q: C 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…
A: DNA is ladder like , two strand structure that act as genetic material in most of Organism.…
Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…
A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…
Q: 5. Answer the following questions concerning protein synthesis a. Describe with drawings how…
A: Protein synthesis is known as translation process that perform synthesis of amino acid chain or…
Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…
A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…
Q: Indicate 2 ways which ensure DNA fidelity when carrying the message to protein which occur in the…
A: DNA fidelity refers to the ability of the DNA polymerase to avoid or rectify the errors made in the…
Q: 6. Please describe the events that may result in a mature protein not having methionine as the…
A: DNA is the carrier for genetic information in almost all organisms except certain RNA viruses. DNA…
Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…
A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…
Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…
A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…
Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…
A: The translation is a process by which proteins are synthesized. It is the last step of the central…
Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…
A: Transcription and translation are the components of gene expression. These two processes are known…
Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…
A: Gene expression is the process by which the instruction in the DNA is converted to products through…
Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…
Q: 1. What are the amino acids translated from the resulting mRNA?
A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…
Q: 1. What are the types and major functions for each type of RNA?
A: NOTE: Since you have asked multiple question, we will solve the first question for you. If you…
Q: 2: Translation Translation MRNA Codon Amino Acid GAA Glu ACG GAU UAC CAG CCC AUG GGC
A: Translation includes the decoding of the information in the mRNA (messenger RNA) into the functional…
Q: 2. Identify the following structures when given images such as the ones below: ● process of…
A: Introduction The cell is the basic structural and functional unit of life present in all living…
Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…
A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…
Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…
A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.
Q: 8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time…
A: Answer : Given in the image
Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…
A: This question we have to describe about process of translation.
Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
A: Ribonucleic acid (RNA) is a genetic material that is prepared from the deoxyribonucleic acid (DNA)…
Q: 2. The sequence of bases in a segment of mRNA is UUUCAUAAG. Answer the following questions: a. What…
A: mRNA is the transcript that is produced during the process of transcription from DNA by the enzyme…
Q: 8.) Answer the following questions regarding the following DNA sequence.…
A: During transcription RNA synthesis occurs over DNA and translation or protein synthesis occurs over…
Q: A tRNA to which the correct amino acid has been attached is called
A: tRNAs bind to codons within the ribosome and deliver amino acids for the protein chain to be…
Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: State the direction of movement of the ribosome along the mRNA strand (the direction of…
A: Protein synthesis involves translation of mRNA into protein that requires three complex stages:…
Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation
A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…
Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…
A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…
Q: 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA.
A: 7. In all living organisms, the material that contains the information which is transmitted from…
Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?
A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…
Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…
A: The central dogma of molecular biology involves the processes of transcription and translation that…
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…
A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…
Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…
A:
Q: The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______…
A: The translation is the process by which protein or polypeptide chain is produced from mRNA. The mRNA…
Q: AAA CC GG G CA GG CCGU Phe Gly Arg
A: * Transcription is the process of copying DNA segment into RNA. *The DNA segments transcribed into…
Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…
A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…
Q: 1. Decoding mRNA into amino acids is called translation.
A: above given statements are about transcription, translation process and how amino acids makes a…
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: 4. Mark the following statements about the genetic code as TRUE or FALSE: The genetic code is…
A: Genetic code is a set of three nucleotides where one triplet is called as one codon.
Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…
A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…
Q: 1. The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase.…
A: Answer:- The process in which the peptide bonds formation occur in between the ribosome called…
Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…
A:
1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA: 5'-ACGTCAATGGA-3' DNA: 5'-GCGCGGATTAGCGAT-3' mRNA: 3'- mRNA: 3'- mRNA: 3'- mRNA: 3'- -5' -5' -5' -5'17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80summarize these results using concise language in a neat table; Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids expected in the final protein (using the MRNA codonstable): DNA TAC CGC TCC GCC GTC GAC AAT ACC ACT MRNA Amino Acid DNA TGA C АTG ATC MRNA AUG ACU AGC UGG GGG UAU UAC U00 UAG Amino Met Ser Trp Tyr Phe Acid DNA TAC CAC CGT ATG GCT GGG AAT ATC MRNA Amino AcidThe sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'
- Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-TyrCATCTACAAATAGCACCTAATTGTG What is the MRNA What is the protein What is the phenotypeA research group has sequenced the cDNA and genomic DNA for a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences. cDNA: 5′–ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCA– GCGGCCAGACTATCACCCAACTCGGTTACCTACTAGTATATC– CCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATA– CAGTATAATCATATA–3′ Genomic DNA (contains one intron): 5′-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAG CGGCCAGACTATCACCCAACTCGGCCCACCCCCCAGGTTTA– CACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCA– AAAAAACCTAGATACCCCACATACTATTAACTCTTTCTTTCTAG– GTTACCTACTAGTATATCCCATATACTAGCATATATTTTAC– CCATAATTTGTGTGTGGGTATACAGTATAATCATATA–3′ Indicate where the intron is located. Does the intron contain the normal consensus sequences for splicing, based on those shown? Underline the splice site sequences, and indicate whether or not they fit with the consensus sequences.
- Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash. Do not put a space in between characters so that LMS will recognize your answer. Message Strand +1 5-TAGTAGGCGGCATGTTTTCCCATACAGATGAAGGATAAACTCGTCT[x]TAT-3' [x]-cleavage site for CFI/CFII endonuclease (for RNA) Genetic Code: Second letter с A G UAUTyr UGC Cys UAC. UAA Stop UGA Stop UAG Stop UGG Trp CAUT CGU CAC His CGC CAA CGA Arg Gin CAGJ CGG AAU Asn AGU Ser AAC. AGC AAA AGA AAG Lys AGG Arg GAU GGU Asp GACJ GGC GAA GGA Glu GAGJ GGG] First letter כ A G U UUU UUC UUA UUGL CUU CUC CUA CUG AUU AUC lle AUA AUG Met GUU GUC Val GUA GUG Phe Leu Leu UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Gly DUAU DUAU DURO DURO A G Third letterIf DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.