1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it up into codons. 3. Plug the codons into the amino acid chart to determine the correct amino acid needed to build that protein. 4. Identify the protein you made by comparing the sequence to the pictures 5. Answer the questions for each protein molecule you build before moving on to the next. Protein 1: DNA AAGACCGTATAC MRNA Amino Acid Sequence

1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it up into codons. 3. Plug the codons into the amino acid chart to determine the correct amino acid needed to build that protein. 4. Identify the protein you made by comparing the sequence to the pictures 5. Answer the questions for each protein molecule you build before moving on to the next. Protein 1: DNA AAGACCGTATAC MRNA Amino Acid Sequence

Name: 1. Using the DNA provided transcribe DNA into MRNA.2. Use the mRNA st
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. Using the DNA provided transcribe DNA into MRNA.2. Use the mRNA strand you created and break it up into codons.3. Plug the codons into the amino acid chart to determine the correct amino acid neededto build that protein.4. Identify the protein yo

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 3SQ: An RNA molecule is typically ______; a DNA molecule is typically______. a. single-stranded;...

See similar textbooks

Similar questions

5. Below is a segment of RNA, transcribed from a DNA sequence. Use the following codon chart to help answer the questions below. 5' AUG/CCU/ACG/GAC/UGG/CCU 3¹ First Letter U C A The genetic code Second Letter A U с G phenylalanine serine tyrosine cysteine phenylalanine serine tyrosine cysteine leucine serine stop G leucine leucine leucine leucine leucine serine proline isoleucine start/ stop histidine stop tryptophan arginine proline histidine arginine proline glutamine arginine proline glutamine arginine threonine asparagine serine isoleucine isoleucine threonine asparagine serine threonine lysine arginine threonine lysine arginine methionine valine valine valine valine a. What polypeptide would be generated by this sequence? alanine aspartate glycine alanine aspartate glycine alanine glutamate glycine alanine glutamate glycine Third Letter DUAGUUAGUUAG C с А UCAG b. The RNA is mutated to: 5' AUGCCCACGGACUGGCCU 3. What type of mutation has occurred? Show the new polypeptide chain. c.…
1. One strand of DNA has the base sequence: CGATTGGCAGTCA T. Determine the sequence of bases in the complementary strand of MRNA that would form next to this DNA strand. a. Write the sequence of bases in the complementary MRNA strand below.
Protein 2: DNA AGAGTTCTGCCCTGTCGATTT MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
4. What does the amino acid chain form? Codon chart: We interpret MRNA 3 base pairs at a time. This is known as a codon. A codon table can be used to translate a genetic code into an amino acid sequence. The full set of relationships between codons and amino acids (or stop signals) is called the genetic code. The genetic code is often summarized in a table like the one below. Second letter C G UAU) TUGU)
1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out) 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter) 3. Look up for each tRNA codon and find the corresponding symbol and amino acid abbreviations. The symbols should spell out a meaningful English message.
8. Below is a double stranded DNA: ATATGTGGTCTCGG TCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the MRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the MRNA transcript. 8.2. 8.3. Identify the polypeptide chain below it. Align the MRNA and polypeptide so that it is clear which DNA bases they came from.
Choose the correct sequence for Translation process. 1. Translocation of the large subunit 2. Formation of peptide bond 3. Translocation of the small subunit 4. TRNA binding O4,1,2,3 O 2,4,3,1 O4,2,1,3 O 1,2,3,4
1. Below is a sequence of mRNA. Use it to answer the questions below. 5' – AACUCCAUGCUUAUUGCUGGCUGAAAUCGACG-3' How many amino acids will be present in the protein? Write the order of the amino acids in this protein. а. b.
Drag and drop the following terms into the correct spots on the image below. 1. Amino Acids 2. Codon 3. mRNA 4. Ribosome 5. tRNA
Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis? 1-ribosome bonds amino acids together; 2-mRNA leaves the nucleus; 3- tRNA molecules pick up amino acids; 4-DNA double helix unwinds; 5-tRNA anticodon links with mRNA codon; 6-polypeptide chain completed; 7-mRNA binds to ribosome; 8-mRNA transcibed