1. Given the piece of MRNA:5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3'1. Predict the DNA strand sequence from which it was transcribe2. List the complementary non-coding DNA Sequence3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.5'- TACCATGAGAATTGTGG TCACCTTTTT-3'3'- ATGGTACTCTTAACACCAGTGGAAAA A-5'MRNA SequenceAmino Acid Sequence

Since you have asked multiple questions, we will answer first question for you. In order to get…

Answered: 1. Given the piece of MRNA:…

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…
Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the sequence of the DNA strand that would be replicated from this one. GTACACATCAGATT 2. White the sequence of the messenger RNA (MRNA) molecule that would be transcribed from the DNA strand. 30 GUACACAUCAGAU00 37 38 39 3. State how many codons the sequence specifies. 40 41 42 43 44 4. State how many amino acids the sequence specifies. 45
1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
8. Below is a double stranded DNA: ATATGTGGTCTCGG TCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the MRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the MRNA transcript. 8.2. 8.3. Identify the polypeptide chain below it. Align the MRNA and polypeptide so that it is clear which DNA bases they came from.
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the mRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' CCGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' mRNA 5' Protein Aline Valine Arginine partic Lysine Asparagine COTOCOAQUC. C FOU U G A Glycine Threonine A GUC A GU G Stop Step Cysteine GTryptophan Phenyl- sarine Lauche C Serie CROUCH UG A C U Hatidine Tyrosine 2060 20/ Leucine Proine
8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine
3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.
26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.
1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence
▼ Part A Enter the corresponding section of mRNA produced from the following section of DNA template strand: 3'AAAACTGTGCAT5' Enter the nucleotide sequence using capitalized abbreviations. 5 3
B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as is true under certain test tube conditions). 5' GTAGCCTACCCATAGG 3' What is the complementary DNA strand? 2. Suppose mRNA is transcribed from this DNA using the complementary strand as a template. What will be the sequence of the mRNA? 3. What would be the corresponding anticodons? 4. What peptide would be made if translation started exactly at the 5' end of this mRNA?
Analysis of a mRNA sample showed that 18% of the nitrogen-base molecules present were uracil molecules. The DNA molecule that was transcribed to form the mRNA sample would most likely contain Select one: a. 18% adenine b. 18% cytosine c. 32% thymine d. 32% adenine O O O

SEE MORE QUESTIONS

Recommended textbooks for you

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code