1. Using the DNA provided transcribe DNA into mRNA. 2. Use the mRNA strand you created and break it up into codons. 3. Plug the codons into the amino acid chart to determine the correct amino acid needed to build that protein. 4. Identify the protein you made by comparing the sequence to the pictures 5. Answer the questions for each protein molecule you build before moving on to the next. Protein 1: DNA A AGACCGTATAC MRNA

Q: Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’…

A: Template strand is the strand of DNA molecule on which the mRNA is synthesized. Complementary strand…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: Hi, Thanks For Your Question.  Answer : Let's Learn Some Basic Concepts First: Transcription : It Is…

Q: The arrow points to which type of structure on the RNA molecule depicted below? 40 Multiple Choice…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: transcribed RNA

A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the  DNA acts as genetic material and transcripted…

Q: 7) A strand of MRNA that is 450 nitrogenous bases long will produce a protein containing…

A: Living cells use a collection of rules called the genetic code to translate information found in…

Q: 2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: mRNA stands for messenger RNA which is a single stranded RNA molecule that is complementary to one…

Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5'…

A: Transcription: The process of formation of RNA from the DNA by  action of DNA dependant RNA…

Q: The direction of MRNA molecule synthesis is . Select one: O a. From DNA strand that starts with 5' O…

A: BASIC INFORMATION TRANSCRIPTION  It is the process in which the genetic information present on one…

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: How is a protein made in the cell? * O One strand of DNA in the ribosome combines with amino acids.…

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…

A: Gene expression is the process by which the instructions in the DNA is converted into a functional…

Q: 1. Determine what amino acid will be formed from the given  DNA strand below:…

A: DNA strands are coiled with each other and form the DNA double helix. Each strand of DNA contains…

Q: Complete the phrases with the correct word or words. The task is to match the lettered items with…

A: Genes are sets of nucleotides that codes for a particular protein. The genes have to be expressed…

Q: DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA

A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: The DNA strand whose complementary RNA contains a stop codon starting at the 5' end DNA A = 5'…

A: In our body genetic information is stored in form of DNA. DNA can be converted to RNA by…

Q: Compare and contrast: TRANSCRIPTION and TRANSLATION Give 2 similarities and 2 differences. Be…

A: Introduction DNA acts as a  genetic material in our body.  DNA contains gene or the basic unit of…

Q: The following is a strand of DNA. Please write out the correct mRNA that ll DNA strand and make sure…

A: Messenger RNA is a single-stranded RNA molecule that is complementary to one of the DNA strands of a…

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 1. One strand of DNA has the base sequence: CGATTGGCAGTCAT. Determine the sequence of bases in the…

A: The sequence of bases of complementary mRNA from DNA strand can be determined as follows: DNA  mRNA…

Q: PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the…

A: the three-letter genetic code is the way by which the cell transcript the information from DNA to…

Q: If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its…

A: DNA and RNA are the two types of nucleic acids. Deoxyribose nucleic acid (DNA) is present in all…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Transcription  Cellular process in which RNA is synthesized using DNA as a template known as…

Q: 4. (a) Create the complementary strand for the DNA strand below. Make sure to write the direction of…

A: DNA is a polynucleotide molecule that stores genetic and hereditary information. DNA is a…

Q: he up with one word, seven letter or more, that can be spelled using only the one letter…

A: Synthesis of proteins from RNA is called translation and synthesis of RNA from DNA is called…

Q: 1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it…

A: # According to our guideline we can answer maximum three sub parts of a questions. So, upload the…

Q: 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.…

A: The double-helical structure of DNA was transcribed into mRNA molecules and these mRNA molecules are…

Q: The code on a DNA strand reads: G C GTAATGA 6. The mRNA strand would read: 7. Use the mRNA to now…

A: We are answering only the first 5 questions. For the rest of the questions please repost. A "nucleic…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…

Q: following is a series of DNA triplets. first, transcribe the correct complementary sequence of mRNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The gene is expressed from DNA into protein by Central Dogma. The transcription and translation…

Q: 1. Decoding mRNA into amino acids is called translation.

A: above given statements are about transcription, translation process and how amino acids makes a…

Q: Use the three letter code for amino acids. If they stop codon is encountered use the word stop…

A: Translation is the process that is responsible for the production of proteins during synthesis.…

Q: Following transcription, the RNA has a complementary sequence of which of the following? Question 9…

A: The process of copying of DNA segment onto an RNA using enzymes and nucleotides is called as…

Q: DNA strand below: 3’ T A C A T G C C G A A T G C C 5’  Discuss how will replication happen by…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis?…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the…

A:

Q: Which type of RNA best fits each of the statements below, respectively? MRNA, FRNA, MRNA, TRNA,…

A: RNA or the ribonucleic acid is a type of nucleic acid that is present in the cell usually…

Q: Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis?…

A: The process of synthesis of proteins is called translation. Proteins are synthesised in a cell in…

Q: Use the model to answer the following questions. 1. Which of the arrows (1 or 2) represents…

A: Transcription is the process of formation of mRNA on DNA template catalyzed by RNA polymerase.…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The central dogma The central dogma is the process involving three major events in cells these are…

Q: Provided below are strands of DNA. The first one has been done for you. First transcribe the code…

A: Answer: CENTRAL DOGMA = It is the complete process of replication of DNA , transcription of RNA ,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.