1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is replaced to A-T, what would the resulting nucleotide be on the mRNA? Briefly justify your answer. 5'-GTAGCCGATAAT-3’ 3'-CATCGGCTATTA-5’

1. Given is a strand of DNA, fill in the corresponding RNA strand and find which amino acids that strand codes for.

1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA product when the DNA is transcribed.c. What is the resulting amino acid sequence which will result from the mRNA?

8. What is happening to the DNA molecule in the figure? Also, discuss the types and functions of enzyme participating in this step.

13. a. Draw in the corresponding DNA nucleotide that would base pair with the adenine nucleotide shown below using the same level of detail as provided in the image below. Hint: Remember that DNA bases pair in the antiparallel orientation. орасна you A OH H b. How do you know the adenine nucleotide drawn above is from DNA and not RNA?

1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction of the sequence. The resulting sequence is given, but without the 3' or 5' ends identified. NOTE the sequence listed is double stranded. (a) Find all START codons (in both directions and for both strands) and report the sequence of the two start codon(s) plus the next 3 bases downstream (i.e. 5' to 3' direction) (b) One of the start codons has a STOP codon 5 codons downstream, list the 18 bases that contain the target sequence and the 6 amino acids that this (very short) open reading frame would translate to (c) BONUS: Identify the 3' or 5' ends for lables1- 4 (1) ATATTAAAAAAGGTTTAGGTACGGAACGTCGAAGAGAACTAAACACAAATTAAGTGACAGACAGTTGTC (2) (3) TATAATTTTTTCCAAATCCATGCCTTGCAGCTTCTCTTGATTTGTGTTTAATTCACTGTCTGTCTACAG(4)

3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short…

8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5-GAATTC-3' 3-CTTAAGS" EcoRI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5'G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.

1. Using this image of DNA & RNA explain the difference between DNA & RNA NH Thymine Cytosine Adenine Guanine Nucleobases of DNA Base pair Helix of sugar phosphates DNA Deoxyribonucleic acid read and then summarize in YOUR OWN WORDS Nucleobases RNA Ribonucleic Acid NH Uracil Cytosine Adenine Guanine Nucleobases of RNA

Pues (two-ringed) 9. (a) Label each nitrogenous base in the double strand of DNA in Figure 4. NEL P-C.₂. H- (a) -CH₂-P-C₂ 5' 0 PCH₂ (b) -Н -CH₂-P-C₂ 5' 0 PCH₂ CH₂-P-C₂ H 0 I' P 5' 0 (d) 3' CH₂ H PCH₂ Figure 4 (b) Figure 4 above shows a phosphodiester bond. Explain what this is. 1.5 Pr