Answered: What determines the sequence of…

What determines the sequence of nucleotides in the template strand of DNA? (The answer can be very basic don’t need lots of details)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 17QP: Chemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?

See similar textbooks

Related questions

Q: we have two or three repeats in our dna sequence, what happens to the de bruijn graph

A: De bruijn graphs are used in bioinformatics. These are used for the de novo assembly of sequencing…

Q: What kind of bond do nucleotides use to form the DNA backbone?

A: DNA (deoxyribonucleic acid) is a biological macromolecule that carries the genetic information for…

Q: why can we not describe the “average” behavior of a DNA molecule? Why is it improbable that proteins…

A: DNA is the molecular name for the molecule in all living things that conveys genetic instructions.…

Q: What is the "pucker" conformation of deoxyribose in the B-form structure of DNA? C2-endo…

A: Sugar puckering :- geometry of ribose sugar have 5 endocyclic TIRTIONAL ANGLES.

Q: If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of…

A: DNA : Deoxyribonucleic acid is a double stranded molecule in which two strands are anti parallel and…

Q: A DNA strand has the following sequence: 5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’ In which…

A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…

Q: How many possible nucleotide sequences are there for a stretch of DNA that is N nucleotides long, if…

A: A DNA nucleotide is composed of five-carbon sugar called deoxyribose, a phosphate group, and one of…

Q: What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…

Q: What is meant by the term DNA sequence?

A: Nucleic acids are the large biomolecules, essential to all known forms of life. They are composed of…

Q: What are some of the important genetic implications of the DNA structure?

A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: Given the following strand of DNA: 5' CATAGCCTTA 3' Which of the following sequences is the…

A: DNA and RNA are nucleic acids present in organisms. DNA is the deoxyribose nucleic acid whereas RNA…

Q: In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of three possible) with G…

A: The DNA (deoxyribonucleic acid) is made up of nucleotide bases that are made up of nitrogenous bases…

Q: After Alfred Hersey and Martha Chase definitively identified DNA as the “Transformative material”,…

A: Alfred Hersey and Martha chase has proved that DNA is the transfer material, which carries all the…

Q: The DNA polymerase cannot start making a new DNA polymer out of nothing, it needs preexisting…

A: DNA molecules makes their own identical copies by a process known as DNA replication. It takes…

Q: Which of the following is NOT true of the structure of DNA? Select one: a. The backbone is made up…

A: It is a molecule composed of two polyneuclotide chains colied around each other to form a double…

Q: What are the four nitrogenous bases and which bases pair with one another in a double-stranded…

A: DNA is a double helical structure that contains genes. Genes are the functional unit of heredity in…

Q: Using the Figure below identify: What is the significance of hydrogen bonds in double helix of DN…

A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…

Q: If A represents 40% of the nucleotides in a particular piece of double stranded DNA, how often will…

A: As per Chargaff's rule, Amount of adenine = amount of thymine Amount of guanine = amount of cytosine

Q: Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA…

A: Ans - a.) 5’- G A G C G A T C G C T C - 3’ 3'- C T C G C T A G C G A G -5'…

Q: Which one of the three parts to a nucleotide is used to determine the 5' to 3' direction of a DNA…

A: A consequence of the structure of nucleotides is that a polynucleotide chain has directionality –…

Q: If one DNA segment has the following base composition, 5'-CAGTTAGC-3', which of the following…

A: Introduction : DNA or Deoxyribonucleic acid is the genetic material found in most living organisms.…

Q: Which travels the farthest shorter or larger fragments of DNA? Why?

A: The technique that is used for the separation of DNA based on its size is referred to as gel…

Q: The helix of an A-DNA differs from the helix of a B-DNA in all of the following EXCEPT which phrase?…

A: DNA (deoxyribonucleic acid) is a type of nucleic acid, which acts as the genetic material. A-DNA,…

Q: The sequence of the DNA template strand is 3’–ATGGCAATAC–5’: What is the sequence of the DNA…

A: DNA stands for Deoxyribonucleic acid. It is a molecule that comprises two polynucleotide chains.…

Q: DNA molecules are anti-parallel strands running 5’ to 3’ or 3’ to 5’. What do 5’ and 3’ correspond…

A: The Central Dogma concept is one of the most important concepts of the living world and is the basis…

Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…

A: Double-stranded DNA consists of two polynucleotide chains each strand having a phosphodiester…

Q: What properties of DNA make it especially well suited to serve as the genetic material?

A: DNA is a type of nucleic acid. It is a polymer of nucleotide. Initially RNA is believed to be the…

Q: How many different 8-mer sequences of DNA are there?

A: Oligonucleotides are short DNA or RNA molecules. They are characterized by the sequence of…

Q: The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a…

A: A double-stranded DNA is joined together by a bond and seems to be a twisted ladder. Which is…

Q: Describe in detail the structure of DNA. Of what is a nucleotide composed? Which are thepurines and…

A: The deoxyribonucleotide acid or DNA is the biomolecule that carries the genetic information coded in…

Q: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents…

A: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) Sense strand is also known as…

Q: A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of…

A: DNA (deoxyribonucleic acid) is a double-stranded molecule and base pairing between two strands is…

Q: When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken…

A: Introduction: DNA is the type of nucleic acid that is present in the nucleus of the cell. It is the…

Q: Which of the following correctly describes the structure of DNA? strands of phosphate-nitrogen…

A: Nucleotides are the molecules that make up DNA. Nucleotides are linked together to form two long…

Q: For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below…

A: Given: a sequence of amino acids, serine-valine-lysine-leucine

Q: Which of the following DNA strands below is expected to have the highest melting temperature?

A: DNA is the genetic material in living beings. It can be seen both in prokaryotes and eukaryotes. The…

Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG is TACTAATAGGATATC.

Q: What does it mean for DNA to be antiparallel? -The two strands of polynucleotides are in opposite…

A: DNA is the hereditary material found in an organism.

Q: what is the biological significance of the different DNA base sequence?

A: The nucleic acids act as genetic material for living beings. The two different nucleic acids are DNA…

Q: What are the features that make the structure of the DNA stable? Explain why the DNA is the genetic…

A: The 3Dimentional double-helical structure of DNA molecule was given by James Watson and Francis…

Q: Why do you think it is important that the sugar-phosphate backbone of DNA be held together by…

A: DNA is made up of nucleotides. Nucleotides contain three units- a pentose sugar, a phosphate group,…

Q: If the first strand of DNA is AGCTGCAAT, what would be the nitrogen base sequence of the second…

A: DNA is a biomolecule which contains two strands. Each strand has a backbone composed deoxyribose…

Q: Which of the following is not part of the DNA backbone?

A: Deoxyribonucleic acid is a molecule with two long strands coiled around a common, imaginary, central…

Q: Let’s say that you want to find out the difference in nucleotide sequence among two DNA strands, one…

A: DNA sequencing is a technique used to study the nucleotides of DNA. It is used to determine the…

Q: What is the best description of how the two strands are aligned with each other in the double helix…

A: Introduction :- Humans and nearly all other species carry their genetic information in DNA, also…

Concept explainers

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.

Question

What determines the sequence of nucleotides in the template strand of DNA? (The answer can be very basic don’t need lots of details)

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

Step 1

dna is the genetic material . it is formed via the polymerization of nucleotides . a dna molecule have two strands which run opposite and antiparallel direction . one strand is 5'-3' while other is 3' -5'

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotide
In clear and concise terms, explain how the biochemical structure of DNA allows it to function as the genetic material. DO NOT write about chemical structure of the monomers. It is about the aspects of the structure of helix that enable it to function as the genetic material. Write your answer in your own words, in 5-6 lines,
Hydrolysis of the N-glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic (AP) site. An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair. Examine the structure of an AP site. H₂N HN N O™ -O-P-O-CH₂ Guanine H₂N N HN Select the chemical consequences that could contribute to DNA instability at AP sites. H H 1₂0/ H fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions decreased interaction between the mutated DNA strand and histones increased ability of the deoxyribose ring to open without the attachment of the purine base H H Guanosine residue (in DNA) O™ -O-P-O-CH₂ O H H H O Apurinic residue H OH H
If A represents 40% of the nucleotides in a particular piece of double stranded DNA, how often will the sequence GG appear? (You can say that GG would be expected to appear, on average, every _____ bases.) SHOW WORK!
Hydrolysis of the N-glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic (AP) site. An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair. Examine the structure of an AP site. HN H₂N N 0 Guanine -O-P-O-CH₂O. H₂N H HN H H H Hod H ofo -0- Guanosine residue (in DNA) -0-CH₂ H H H Apurinic residue H OH H
DNA sequences have an alphabet {A,C,G,T}. How many DNA sequences of length n are there? (Two DNA sequences are the same if one is the reverse of the other).
In general, which part of a DNA sequence will have the best quality? (Ex. Beginning, middle, end?) Why?
If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.
I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946 nucleotides long. The urn contains 259 Adenines, 699 Cytosines, 401 Thymines and 587 Guanines How many start codons will I find on average in the entire sequence when I draw all of the bases from the urn without replacement? Please I'm not too sure how to tackle this.
In a sample solution given to be analyzed;CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning.
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? How many full double-helical turns does this DNA contain?