5'-CATATAGTCAATCTCGATTAG-3' 3'- GTATATCAGTTAGAGCTAATC-5'
Q: Free DNA nucleotides bonds with the exposed complementary bases on the RNA template strand II. Poly…
A: The process of the formation of identical copies of DNA is called replication. It occurs in the…
Q: 2. The following figure represents the primary transcript of a typical eukaryotic protein-coding…
A: Eukaryotic protein-coding genes are segments of DNA in eukaryotic organisms that contain…
Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…
A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…
Q: 1. Differentiate the genotype and phenotype of a cell. 2. If deoxyribonucleotides that lack the…
A: In an organism the genetic matter is present inside the genes present in the chromosome of the…
Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…
Q: If an MRNA is alternatively spliced, then different introns are removed from a pre-MRNA, producing…
A: Alternative splicing is the process of splicing different combinations of splice sites with a…
Q: . What are three differences between RNA and DNA?
A: As per our honor code, We are authorized to answer one question at a time, since you have not…
Q: Identify the term being asked by the statement: a. It describes mRNA that results in a single…
A: The RNA is produced from the DNA by the transcription process and the mRNA is used for the protein…
Q: a. Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…
A: RNA Splicing: A newly created precursor messenger RNA (pre-mRNA) transcript is converted into a…
Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…
A: transcription is the process by which messenger rna is made from dna .
Q: . Which of the following statements about the flow of genetic information is correct? A. Translation…
A: Genes are the basic hereditary molecules that carry hereditary information in them. They are present…
Q: Alternate splicing: A. Reduces mRNA half-life by shortening poly(A) tails B. Disrupts histone…
A: Introduction In Molecular Biology, RNA Splicing Is The Process By Which A Newly Synthesised…
Q: Shown below is diagram of RNA polymerase undergoing the process of transcription: This transcript:…
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: 6)Select ALL of the following that apply to transcription. Select one or more: a. occurs in the…
A: Transcription is that the method by which the information during a strand of deoxyribonucleic acid…
Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…
A:
Q: 10. (a) What are exon and intron? Explain the process of RNA splicing to highlight that different…
A: Given: RNA splicing is a molecular biological process in which newly synthesised MRNA transcribed…
Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…
A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…
Q: 1) Describe the dna transcription-mRNA with all the step.
A: The discovery of DNA as genetic material is one of the most significant discoveries in molecular…
Q: What is a consensus sequence? What are the components of RNA polymerase and what are their functions
A: RNA polymerase is an enzyme that catalyzes the synthesis of RNA from RNA template.
Q: d. O b. protein coding DNA that is transcribed into RNA and then translated into protein O c.…
A: The non-coding DNA sequences are the part of an organism's genome that doesn't encode amino acid…
Q: 5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several…
A: Introduction Marshall Nirenberg discovered a way to determine the sequence of the letters in each…
Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…
A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…
Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…
A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…
Q: State if each statement is true or false: a. Competent cells are bacterial cells that contain the…
A: All organisms are made up of cells. Cell are dignified as the basic building blocks of life. Cells…
Q: 1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA…
A: Transcription is the process of copying information from a strand of DNA to a newly synthesized…
Q: 19.Examine the following DNA sequence and determine what type of mutation, if any, produced the…
A: Mutations are certain modifications takes place in the sequence in DNA . Mutations is classified as…
Q: 7. A molecule of mRNA from bacteria is shown below: 5'- GUUUCCGAGGAGGCGUAUACAUGUCAGUGGGGGC... -3'…
A: Protein synthesis or translation is the final step of gene expression. This process is divided into…
Q: a. b. What constitutes the protein-coding region of a mature mRNA molecule?
A: INTRODUCTION The process of copying a segment of DNA into mRNA known as transcription. In the DNA…
Q: I. List the sequences of RNA that would be transcribed from the following DNA template sequences. а.…
A: Transcription is the initial stage in gene expression, when genetic information is utilised to build…
Q: A 5' -I D.
A: DNA replication is that the method by that a double-stranded deoxyribonucleic acid molecule is…
Q: D. Fill in the table below. Determine the correct template and coding strands to properly answer…
A: DNA is a double helical macromolecule that has genes that contain the necessary information for the…
Q: . Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate…
A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…
Q: transcription should be done from the 5' DNA chain. 1. a. 3' DNA: b. 5' DNA: c. mRNA: d. Amino…
A: This exercise involves the process of replication, transcription and translation. In the process of…
Q: Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds…
A: Gene is present on a chromosome and contains hereditary information. These genes are later…
Q: Identify the parts of a matur mich of the following is found in nucleotides 5 can
A: mRNA or messenger RNA are polynucleotide molecules having backbone of ribose sugar and phosphate.…
Q: 18. While studying a human patient with hemophilia, you have discovered that the second exon of the…
A: Transposable elements also are known as jumping genes. These are those DNA sequences that can change…
Q: Select ALL of the following that apply to translation. Select one or more: a. occurs in the nucleus…
A: The translation is a process that is part of the central dogma that follows the process of…
Q: 30. How can one identify the presence of introns in a hybrid of DNA and mRNA? Give an example of…
A: Introns are non-coding sequences, whereas exons are coding sequences. Splicing is the process of…
Q: tight packing of previously less condensed chromatin identify which describes the statement…
A: Post translational modifications in histone proteins can change the shape of chromatin, which can…
Q: Identify the sites of lagging strand synthesis. Select all that are true. B
A: DNA replication of the double-stranded DNA occurs simultaneously at both strands. The replication…
Q: 18) MUTATIONS: A. Explain the difference between a point mutation and a frameshift mutation. B.…
A: Mutations are the gradual changes that occur in our DNA sequence because of several factors such as…
Q: Select all the correct types of RNA that are both the product of transcription and are also…
A: RNA plays a very important role in biological processes and also acts as Genetic material in some…
Q: a. As a result of the structure of DNA and RNA, replication, transcription and translation are…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
1. From the given DNA strands:
a. Identify the template and non-template strand.
b. Give the mRNA product when the DNA is transcribed.
c. What is the resulting amino acid sequence which will result from the mRNA?
Step by step
Solved in 1 steps
- III. Discuss the following aspects of translation: 1. How does the location and timing of transcription/translation differ between prokaryotes and eukaryotes? 2. How do the types of ribosomes differ between prokaryotes and eukaryotes? 3. How does the first amino acid of the translated protein differ between bacteria, archaea, and eukaryotes?I. RNA polymerase binds to the promoter and the DNA unwinds. II. RNA polymerase moves along the DNA template and will synthesize mRNA. III. General transcription factors arrive and recruit RNA polymerase to the promoter. IV. The newly synthesized mRNA is processed and exported from the nucleus. Which of the following sequences shows the correct order for overall events of transcription? A. I, II, III, IV B. I, III, II, IV C. III, II, I, IV D. III, I, II, IV2. Define each of these processes that are essential to the formation of a protein. a. Transcription b. Translation translation is the process of generating polypeptide using the information carried on an MRNA molecule. 3. Complete the table to summarize each process Process Template Product Synthesized Location in Eukaryotic Cell Transcription Translation 4. Write the central dogma of molecular genetics, as proclaimed by Francis Crick? 5. How many nucleotide bases are there? 6. How many amino acids? (Hint: look at page 77 of your book) 7. DNA is double stranded, but for each protein, only one of these two strands is used to produce an MRNA transcript. What is the strand called? 8. Here is a short DNA template. Below it, assemble the complementary MRNA strand. Recall that DNA-DNA, DNA-RNA, and RNA-RNA strand interactions are antiparallel. This means Vour MRNA strand will run 5' to 3'
- 1. Draw your own version of the Central Dogma below, being sure to include the terms translation, transcription and synthesis. 2. Fill in the following chart regarding the Central Dogma: Transcription Translation Goal (outcome) Required molecules Location where it Occurs Post-event modifications 3. Identify the three main types of RNA and explain the function of each. 4. What is the genetic code and what is it used for?Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) A 3' TACATGG'TTGTGCTAATT 5'
- Define (whether post-transcriptional, post-translational, transcription) and describe the regulation of the Ferretin mRNA in the diagram below.A. In transcription, a region of DNA opens up. One strand, the template strand, serves as a template for synthesis of a complementary RNA transcript. The other strand, the coding strand, is identical to the RNA transcripf in sequence, except that it has uracil (U) bases in place of thymine (T) bases. Given the following piece of messenger RNA (MRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC... Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to the template strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 2. List the DNA strand sequence complementary to the template strand. This refers to the coding strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 3. List the amino acid sequence of the protein coded for. (Please insert a space every after one amino acid for easy checking of your papers. Thank you.)1. Determine the following statements if they are true or false. a. In recombinant DNA technology, the DNA of the same organism may be reinserted back into that organism b. Transcription factors are proteins that have only one type of DNA-binding motif. c.The polyadenine TAIL remains ATTACHED to messenger RNA until translation.
- Arrange the statements in their proper order by writing the corresponding letter (e.g. A) for each statement in the space provided below. A. The single-stranded RNA would complement the target RNA. B. Gene expression is inactivated once the mRNA is no longer accessible for translation. C. The risk-induced silencing complex which is composed of RNA and protein subunits is formed. D. Double-stranded, non-coding RNA is cleaved by Dicer. E. The mRNA can be cleaved or remain bound by the RISC. 1. 2. 3. 4. 5.Table of the Standard Genetic Code Middle base 5'- C_-3' UCU Ser (S) |UAU Tyr (Y) UCC Ser (S) UAC Tyr (Y) UCA Ser (S) UCG Ser (S)UAG Ter CCU Pro (P) CAU His (H) CCC Pro (P) CCA Pro (P) CAA GIn (Q) CCG Pro (P) CAG GIn (Q) 5'- _U -3' 5'-_A_-3' 5'-_G_-3' 5'-U_-3' UUU Phe (F) 5'-U_-3' UUC Phe (F) 5'-U_-3' |UUA Leu (L) 5'-U_-3' UUG Leu (L) 5'-C_-3' |CUU Leu (L) 5'-C_-3' |CUC Leu (L) 5'-C_-3' CUA Leu (L) 5'-C_ -3' CUG Leu (L) UGU Cys (C) 5'-_U-3' 5'-_C-3' 5'-_A-3' UGG Trp (W) 5'-_G-3' 5'- U-3' 5'-C-3' 5'-_A-3" 5'- G-3' 5'- U-3' 5'-_C-3' 5- А-3' 5'-_G-3' GCU Ala (A) GAU Asp (D) GGU Gly (G) 5'-_U-3' 5'-C-3' GGA Gly (G)5'-_A-3' GGG Gly (G) 5'-_G-3' UGC Cys (C) UGA Ter UAA Ter CGU Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) ACU Thr (T)|AAU Asn (N) AGU Ser (S) AAC Asn (N) AGC Ser (S) AGA Arg (R) AGG Arg (R) CAC His (H) 5'-A_-3' |AUU lle (1) 5'-A_-3' AUC Ile (1) 5'-A_-3' |AUA lle (1) 5'-A_-3' |AUG Met (M) ACG Thr (T) AAG Lys (K) 5'-G_-3' GUU Val (V) 5'-G_-3' GUC Val (V) 5'-G_-3' GUA Val (V)…2) Create an MRNA strand based on the given DNA template strand: TACTT CCTATTITCT IGTCA CCGCACT
