If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side? AAATCGG * O CCCATGG TTTGCAA O UUUAGCC O TTTAGCC

Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW ON PAPER

What would be the percentage of G, C, A, and T in each column? Have to calculate the nucleotide frequency from my sequence.

Produce the RNA strand that would be read from the DNA strand T -- A C -- G C -- G A -- A -- C -- G -- T -- T-- A -- ف في ن

DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!)       tRNA anticodon (No thymine in RNA!)       Amino acid Use the mRNA with the Genetic Code.       Use the mRNA with the Genetic Code. Answer the questions below.   Questions How many nucleotides would be needed to code for a protein that has 100 amino acids?   Using the Genetic Code in Table 6.3, write all of the possible codons that signal the start and end of a gene. Start: End: An amino acid sequence of a protein molecule includes methionine, lysine, serine and glycine. Show each different codon that could result in each of these amino acids. You will have more than one codon for all of them except methionine. Amino Acids All Possible Codons Methionine   Lysine   Serine (Look carefully. There are six possibilities)   Glycine   Question 3 illustrates the redundant nature of the genetic code. Can you think of an advantage of having several codons that all code for the…

Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH

Write the sequence of the DNA strand complementary to the following strand: AAATTTCGATCCCGGGAAATTTAGACCCGGGTTTAAACCCCGCAT

draw the structure of the polynucleotide GT

Suppose you have subjected the two given samples of EcoRl digested DNA to get electrophoresis. Draw a diagram of the expected gel to show the location of the cut DNA pieces. 

Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine