8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5'-GAATTC-3' 3-CTTAAG-S" ECORI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5-G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.

G3 62 GI G 4 GGU W AUG GCC AUG CUC ACG GAG CUC UUC UAC CGG R (the strand) Y CUC GAG AAG The original template for this process is: O DNA O MRNA O TRNA O FRNA & 5 6 7\ 9. t O o o

Assume that you are a RNA polymerase. Which strand is the template strand?                                                                   -5                             ↓ 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’

The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'.TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'.AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. d Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 -41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?