if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the sequence: 3’ UACGCA5’ 3’AUGCGU 5’  3’ ATGCGT 5’  3 TACGCA 5’ 3’ ATGCGT 5’

19. Match the letters with the enzymes and macromolecules involved in DNA replication: A E B DNA POLYMERASE CATALYZES COMALENT LINKAGE OF NUCLEOSIDE TRIPHOSPHATE INTO GROWING NEW STRAND INCOMING NUCLEOSIDE D' TRIPHOSPHATE PAIRS WITH A BASE IN THE TEMPLATE STRAND A) i) pyrophosphate (Pi) ii) template strand ii) incoming nucleoside triphosphate iv) new strand v) DNA polymerase

10. A picture of a replication bubble is shown below. でイトイOpイ TT 3 Primer 5'-CUU-3" is being used to replicate this picce of DNA. What strand this primer will anneal to: the upper or the lower? Write what product of RNA replication would be the first five nucleotides that had been added onto the primer by DNA pol. Mark the 5' and 3' ends. lin

1. Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’   A. How many Phosphodiester bonds are required to form this segment of double-stranded DNA? B. How many hydrogen bonds are present in this DNA segment?

E.coli is replicating its chromosome. If the template DNA sequence is: 3' AAA CGC GAT 5', what would be the base sequence of the complementary new DNA strand? O 5'TTT GCG CTA 3' 5' UUU GCG AAU 3' O 3' UUU GCG AAU 5' O 3' TTT GCG AAT 5'

On paper, replicate the following segment of DNA:            5’ A T C G G C T A C G T T C A C 3’            3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?

28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…

Which of the following sequences is the best description of the complementary DNA sequence to the following sequence:   5'-CGATTAGC-3' Group of answer choices 5'-GCTAATCG-3' 5'-GCUAAUCG-3' 3'-CGATTAGC-5' 3'-GCUAAUCG-5' 3'-GCTAATCG-5'

7. What are the 4 nitrogen bases? 1. 2. 3. 4. 8. What is their purpose? Why does their order matter? Answer in complete sentences. How does this structure allow a DNA molecule to be copied to make another identical molecule? The answer to this question is that the nitrogen bases interact with one another in predictable ways. Pairing between nitrogen bases on opposite strands is always the same. Notice that the pairing that takes place between nitrogen bases is specific in DNA strands. Adenine, a large base, bonds with thymine, a small base. Guanine, a large base, bonds with cytosine, a small base. This specific bonding pattern that happens between the nucleotides is called complementary base pairing. 9. How do the bases pair? How are A and G similar? How are T and C similar?

18. If 32P is used to label both strands of double-stranded DNA, after two rounds of replication, four double-stranded molecules of DNA are produced. Of these,a. one of the four double-stranded molecules of DNA will contain all the 32Pb. two of the four double-stranded molecules of DNA will contain 32P, each with half of the 32Pc. three of the four double-stranded molecules of DNA will contain 32P, each with 1/3 of the 32Pd. all four double-stranded molecules of DNA will contain 32P, each with ¼ of the 32Pe. none of the double-stranded molecules of DNA will contain 32P