Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 13QP
Determine the percent of the following gene that will code for the protein product. Gene length is measured in kilobases (kb) of DNA. Each kilobase is 1,000 bases long.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The mass of mRNA that has copied a segment of DNA is 36,000 units, the mRNA is placed in the ribosome and represents 60% of it. Determine the mass of the protein encoded by the gene, if the mass of the amino acid is 110 and the mass of the nucleotide is 300.
The mass of RNA that has copied a segment of DNA is 63,000 units. The RNA mass that is placed in the ribosome represents 60% of it. Determine the mass of the protein encoded by the gene, if the mass of the aminoacid is 110 and the mass of the nucleotide is 300.
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC
What human disease has been connected to this gene? Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
Chapter 9 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - The Link Between Genes and proteins The genetic...Ch. 9 - Define replication, transcription, and...Ch. 9 - If the genetic code used 4 bases at a time, how...Ch. 9 - If the genetic code uses triplets, how many...Ch. 9 - What is the start codon? What are the stop codons?...
Ch. 9 - Is an entire chromosome made into an mRNA during...Ch. 9 - The promoter and terminator regions of genes are...Ch. 9 - The following segment of DNA codes for a protein....Ch. 9 - What are the three modifications made to pre-mRNA...Ch. 9 - The pre-mRNA transcript and protein made by...Ch. 9 - Briefly describe the function of the following in...Ch. 9 - Prob. 12QPCh. 9 - Determine the percent of the following gene that...Ch. 9 - How many kilobases of the DNA strand below will...Ch. 9 - Prob. 15QPCh. 9 - Given the following tRNA anticodon sequence,...Ch. 9 - Given the following mRNA, write the...Ch. 9 - The following is a portion of a protein:...Ch. 9 - Below is the structure of glycine. Draw a...Ch. 9 - Indicate in which category, transcription or...Ch. 9 - Prob. 21QPCh. 9 - Polypeptide folding is often mediated by other...Ch. 9 - Do mutations in DNA alter proteins all the time?Ch. 9 - a. Can a mutation change a proteins tertiary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.arrow_forwardYou are trying to isolate a protein you don't know much about, so you decide to use a gel column chromatography. You do as much research on this protein as possible and realize that this protein contains A LOT of aspartic acid and glutamic acid. Knowing this, what column would you choose, and which tube would you expect to find your protein (the first tube or the last tube)?arrow_forwardThe following list of proteins are found in a mixture and are to be separated by 2D gel electrophoresis: Molecular weight (Daltons) Protein Isoelectric point Myoglobin 17,000 7.0 Cytochrome C 12,000 10.6 IgG 150,000 6.4 Hemoglobin 64,500 7.1 Insulin 5,800 5.4 Human serum albumin 66,000 4.6 Histone H3 15,000 10.8 Рepsin 33,000 1.0 In 2D electrophoresis, the mixture is first subjected to isoelectric focusing, separating them via their isoelectric pH values (corresponding to the horizontal axis, then subjected to SDS-PAGE to separate via molecular weight (corresponding to the vertical axis), where large proteins stay at top and smaller proteins go towards the bottom. 2 4 pH 7 10 direction of electric current 150 MW (kDa) 100 В E A 50 2 4 pH 7 10 With this information, match the letters of the bands to the proper protein based on the data given. Band Letter Protein A D Earrow_forward
- Top of gel Std MW's 105,000 84,000 50,500 37,000 29,000 DO 21,000arrow_forwardA researcher isolates a new protein and finds that it contains 0.755% serine by weight upon amino acid analysis. The molecular mass of serine is 105 g.mol-¹. What is the minimum molecular mass for the protein assuming only one Ser residue per protein molecule? mmin = The researcher estimates the molecular mass of the protein using gel electrophoresis. From this estimated molecular mass, the researcher concludes the protein contains 3 Ser residues. What is the estimated molecular mass of the protein as shown by gel electrophoresis? g.mol-¹ mest = g.mol-1arrow_forwardA protein has a molecular mass of 400 kDa when measured by size-exclusion chromatography. When subjected to gel electrophoresis in the presence of sodium dodecyl sulfate (SDS), the protein gives three bands with molecular masses of 180, 160, and 60 kDa. When electrophoresis is carried out in the presence of SDS and dithiothreitol, three bands are again formed, this time with molecular masses of 160, 90, and 60 kDa. Determine the subunit composition of the protein and clearly explain how you came to this determination.arrow_forward
- The E. coli DNA molecule contains 4.70 x 105 base pairs. Determine the number of codons that can be present in this DNA molecule. number of codons: 1.57 x106 codons Assuming that the average protein in E. coli consists of a chain of 420 amino acids, calculate the maximum number of proteins that can be coded by an E. coli DNA molecule. number of proteins: proteinsarrow_forwardA DNA sample contains 21% adenine. What is the complete percentage base composition?arrow_forwardA compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY