Microbiology With Diseases By Taxonomy (6th Edition)
6th Edition
ISBN: 9780134832302
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 8, Problem 6CT
Summary Introduction
To describe:
The number of
Introduction:
The
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Cellular DNA replication uses the enzymes for the process while PCR uses thermal denaturation that helps seperate DNA strands.
I need a picture that shows the difference between them two using the statement above.
The way PCR amplifies DNA is similar to the doubling in apopulation of growing bacteria—a single DNA strand is used tosynthesize 2 DNA strands, which become 4, then 8, then 16, etc. If acomplete cycle takes 3 minutes, how many strands of DNA wouldtheoretically be present after 10 minutes? After 1 hour?
The following image is of an agarose gel. If DNA samples were loaded to this gel and the electrophoresis experiment was started, explain what would happen and why.
Chapter 8 Solutions
Microbiology With Diseases By Taxonomy (6th Edition)
Ch. 8 - Why did the discovery and development of...Ch. 8 - Why wasnt polymerase chain reaction (PCR)...Ch. 8 - Why dont doctors routinely insert genes into their...Ch. 8 - Why dont scientists who work with recombinant DNA...Ch. 8 - Which of the following statements is true...Ch. 8 - A DNA gene synthesized from an RNA template is...Ch. 8 - Prob. 3MCCh. 8 - Prob. 4MCCh. 8 - Prob. 5MCCh. 8 - Prob. 7MC
Ch. 8 - Prob. 9MCCh. 8 - Prob. 10MCCh. 8 - Prob. 1MTFCh. 8 - Prob. 2MTFCh. 8 - Prob. 3MTFCh. 8 - ________ Protoplast fusion is often used in the...Ch. 8 - Prob. 5MTFCh. 8 - Describe three artificial methods of introducing...Ch. 8 - Prob. 2SACh. 8 - Prob. 3SACh. 8 - List three potential problems of recombinant DNA...Ch. 8 - Examine the restriction sites listed in Table 8.1...Ch. 8 - Prob. 2CTCh. 8 - A thermocycler uses DNA polymerase from...Ch. 8 - How is the result of a Southern blot similar to...Ch. 8 - Prob. 6CTCh. 8 - Prob. 8CTCh. 8 - Prob. 9CTCh. 8 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- During PCR, the reaction mixture cycles through three temperatures (for example 94, 60, and 72 degrees Celsius) multiple times. What happens during the 94 degree part of a cycle? Group of answer choices Double-stranded DNA denatures and becomes single-stranded. DNA polymerase synthesizes daughter DNA molecules. An oligonucleotide primer anneals to a template DNA strand.arrow_forwardTo amplify a section of DNA using the polymerase chain reaction (PCR), all you need to load into the tube is 1) a buffer solution, 2) the DNA you want to amplify, 3) some DNA nucleotides, 4) a polymerase (like Taq polymerase), and O an RNA polymerase a set of forward and reverse primers some phospholipids for a cell membrane some ribosomesarrow_forwardThe image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicases, primase, DNA polymerase III, DNA polymerase I, and ligase. Also, be sure to indicate the 5' and 3' ends of all nucleic acid polymers.arrow_forward
- The image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicase, primase, DNA polymerase III, DNA polymerase I and ligase. Also be sure to indicate the 5’ and 3’ ends of all nucleic acid polymers.arrow_forwardOrder the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of DNA to be sequenced add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase a primer binds to the single-stranded DNA template DNA polymerase extends the primer, incorporating deoxynucleotides a labeled dideoxynucleotide terminates the growing DNA chain gel electrophoresis separates the mixture of DNA fragments by size The DNA sequence is determined denature the double-stranded DNA Answer Bankarrow_forwardcompare and contrast DNA replication in the cell with PCR-based replication in the lab. Do these two processes use the same number of proteins, why or why not? What reagents are added to a PCR reaction and are the primers used in both made of the same material? What about the requirements of the replication fork, same or different?arrow_forward
- If you were to set up a PCR reaction (in vitro DNA synthesis) with a DNA template, primers,DNA polymerase, DATP, dGTP, dCTP, dTTP and a small amount of ddATP, what would be the result? DNA synthesis would happen normally. All DNA molecules produced would be the same length as the template. DNA synthesis might be terminated after the addition of any adenine base (at random). DNA molecules of many different lengths would be produced. DNA synthesis would be terminated after the first adenine base is added. All DNA molecules produced would the same length, shorter than the template.arrow_forwardSee the restriction enzyme map below. The total DNA length is 1800 base pairs. If this DNA is cut using three restriction enzymes, namely Kpnl, Sall and EcoRI, it yields four fragments with sizes of 390 bR. 810 bp, 270 bp www and 330 bp. Kpnl Sall EcoRI 390 810 270 330 1800 bp 1. If you were to subject this digested DNA to agarose gel electrophoresis, what would your gel look like? Draw a detailed picture of your gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. 2. You are provided with coiled DNA and plasmid DNA that you subject to gel electrophoresis. Draw this gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. Exac fragment sizes are not important.arrow_forwardPCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCGȚAGCTATATGCTATCGTGACGTATCGGCGCATTAAȚCGGGATCGAT 3 50 3' TGGCÁTCGATATACOATAGCACTOCATAGCCGCGTAATTÀGCCCTAGCTÀ 5' 5' AGCTÇGCTAGCAGGAGAGAȚATCGÇTCATAGCTCCGATCGATGCCGCTAA 3 3' TCGAGCG ATCGTCCTCTCTÁTAGCGAGTATCGAGÓCTAGCTACGGCGATİ 5' 100 5' TATAGCTCTÇTGCGGATATÇGCATATACCẠ AGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACOCCTATAGCGTATATGGTTCCGGGATGČATACATCGAŤ 5' 5 TGCGTATATÇGGAGAGTCCTGGATATGGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCÁTATAGCCTCICAGGÁCCTATACCTCGAACTGACGTCTCTCGAGCT 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 3. ATACGCGAATCCGGCATATACGAACCCCTÍTCGAGATACATACGATACAC 5' 250 5' TGCATGTGCTATGCAACGTTCOGATTGCGȚAGCAGTAATAGCGCCGATTG 3 300 3'…arrow_forward
- During agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricityarrow_forwardThe way that PCR amplifi es DNA is similar to the doubling in a population of growing bacteria; a single DNA strand is used to synthesize 2 DNA strands, which become 4, then 8, then 16, etc. If a complete cycle takes 3 minutes, how many strands of DNA would theoretically be present after 10 minutes? After 1 hour?arrow_forwardWhich of the following steps is NOT part of a typical polymerase chain reaction? Choose an answer below: primer annealing ligation of DNA fragments by DNA ligase primer extension by DNA polymerase heat denaturation of double stranded DNA none of the abovearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License