The reason why researchers conducted experiments in which they did not add protein subunits and RNA (Ribose nucleic acid ) subunits to measure the formation of mature transfer RNAs. Introduction: RNase P acts as a catalyst during the processing of transfer RNA (Ribose nucleic acid) molecules. RNase P contains two subunits- one is a RNA molecule that possesses 377 nucleotides and other is a small protein molecule having a mass of 14 kilo Dalton. Altman and his colleagues purified this RNase P molecule and studied their important properties.

Question

Want to see the full answer?

Answer 1

Question

Chapter 6.2, Problem 2EQ

Summary Introduction

To determine: The reason why researchers conducted experiments in which they did not add protein subunits and RNA (Ribose nucleic acid) subunits to measure the formation of mature transfer RNAs.

Introduction: RNase P acts as a catalyst during the processing of transfer RNA (Ribose nucleic acid) molecules. RNase P contains two subunits- one is a RNA molecule that possesses 377 nucleotides and other is a small protein molecule having a mass of 14 kilo Dalton. Altman and his colleagues purified this RNase P molecule and studied their important properties.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…

Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.

Q.) A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give examples? B.)aminoacyl tRNA synthetase is specialized or not ? And why?