Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 33, Problem 3P
Interpretation Introduction
Interpretation:
The radius of histone octamer should be calculated.
Concept introduction:
A base-pair is unit, which is composed of two
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Read it carefully.. Draw only correct diagrams..
In the Watson-Crick DNA base pairing model, Adenine (A) binds to thymine (T), guanine (G) binds to cytosine (C).
1. Draw the structures of thymine and adenine stabilized by Watson-Crick base pair interaction.
2. Also draw the structure of the amide group of glutamine in an interaction of this T-A pair in a way that maximally satisfies the hydrogen bonding capacity of amide.
. Pancreatic deoxyribonuclease I (DNase I) is a nuclease that makes
single-strand nicks on double-stranded DNA. It has been observed
that treatment of nucleosomal core particles with DNase I yields a
peculiar result. When DNA from such a digestion is electrophoresed
under denaturing conditions, the single-stranded fragments are
observed to occur in a regular periodicity of about 10 bases. Suggest
an explanation of this result in terms of the structure of the nucleo-
some.
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- A diploid human cell contains approximately 6.4 billion base pairs of DNA. Q.How many histone proteins are complexed with this DNA?arrow_forwardPlease help me with this question. How many amino acid residues are in the heavy and light chains of the Fab fragment, and how many amino acid residues are in lysozyme?arrow_forwardPlease convert it to past tense and passive voice. Each group will be provided with two 20 g double-stranded DNA oligomers A and B in STE buffer (0.1M NaCl/ Tris/ 10 mM EDTA, pH 7.4). The sequence of the two oligomers used in this experiment is:5’ GCATTGCGCAGGGCCGAG 3’ (GC rich) 3’ AATGGTACGTATACTTTAT3’ (AT rich)In this experiment, you are going to identity oligomer samples A and B, GC or AT rich, by UV spectrophotometric method.1. Pipet 1 ml of each oligomer into a 1.5 ml Eppendorf tube and label the two tubes A and B.2. The absorption wavelength is 260 nm. Use STE buffer provided to set blank.3. You will be provided with two cuvettes. Use separate cuvette for each DNA sample.4. Transfer 1 ml of DNA sample A to cuvette and measure the UV absorbance at 260 nm (A260) atroom temperature. Repeat this step for Sample B.5. Transfer the DNA back to the original Eppendorf tube, close it and heat it to 45C for 7 minutes.6. Quickly transfer the sample from Eppendorf tube to cuvette, and…arrow_forward
- Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the impact of the disease on society.Describe a way in which your gene can be manipulated to treat the disease. Assume you can make any changes to the protein product and describe specifically how it will affect its interaction with other molecules.arrow_forwardThis is DNA. Locate the nitrogen bases (nitrogens are blue). Where are they located in the molecule?Locate the sugars and phosphates, and describe their location. Adjacent nucleotides are linked by covalent phosphodiester bonds (-O-P-O-) produced by a condensation reaction. What parts of the adjacent nucleotides are linked by phosphodiester bonds?Two nitrogenous bases extending towards the middle of the double helix. Are there any covalent bonds between these bases?If there are no covalent bonds between these bases, what other kinds of bonds might hold the two strands of the double helix together?arrow_forwardPart I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forward
- Polymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forwardN. NH 2. One of the key pieces of information that Watson and Crick used in determining the secondary structure of DNA came from experiments done by E. Chargaff, in which he studied the nucleotide composition of DNA from many different species. O=P-OCH, N. `NH, HN он O= P- OCH, NH, Chargaff noted that the molar quantity of A_was always approximately equal to the molar quantity of T. and the molar quantity of C was always approximately equal to the molar quantity of G. How were Chargaff's results explained by the structural model of DNA proposed by Watson and Crick? N OH N. O= P-OCH, OH OHarrow_forwardDNA Structure A. Draw an A-T base pair with the appropriate number of hydrogen bonds. You don’t have to include all the details such as every side-group but do depict the 3’ OH groups. B. What is meant by anti-parallel when referring to a DNA molecule? C. What are the major and minor grooves in the DNA structure and what significance do they have?arrow_forward
- Assuming that 145 base pairs of DNA wrap around the histone octamer 1.75 times, estimate the radius of the histone octamer. Assume 3.4 Å per base pair and simplify the calculation by assuming that the wrapping is in two rather than three dimensions and neglecting the thickness of the DNA.arrow_forwardUsing Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.arrow_forwardproteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license