Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 24, Problem 26ESP
Summary Introduction
To explain: The mechanism due to which the individuals can carry a fusion gene that is transcriptionally active and yet do not develop chronic myelogenous leukemia (CML).
Introduction: Chronic myelogenous leukemia (CML) is generally diagnosed in older adults. A spontaneous chromosomal mutation causes this disease. It is known that the BCR-ABL fusion protein is found only in CML white blood cells. This abnormal protein has a specific function that directly contributes to the development of CML.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The p53 protein was discovered through its association with SV40 T antigen and assumed initially to be an oncoprotein.
a. What is the current consensus as the function of p53 and what evidence caused this change in view?
b. How does the effect of mutation in the p53 gene differ from the effect of mutation in the RB gene what is the molecular basis for this difference ?
The mouse thymus normally contains about 1–2 ´ 108 thymocytes, the vast majority of which are CD4+CD8+ (double-positive) cells. When thymocytes from mice with a gene deficiency in the TCRa locus are compared with those from TCRb-deficient mice, a striking difference between the two different knockout lines is observed, as shown in the figure below in a simplified version of flow cytometry data. The numbers of thymocytes in each thymus is indicated below the plots.
What is the explanation for the difference in thymocyte subsets and cell numbers observed when comparing TCRa-/- to TCRb-/- thymocytes?
Which region of the thymus organ would show a dearth of developing thymocytes in the TCRa-/- thymus? Which region in the TCRb-/- thymus?
please help me I can't find answers for these questions: here is the link for the article
https://www.pbs.org/wgbh/nova/transcripts/2805cancer.html
What type of substances are angiostatin and endostatin and where are they produced? What do they do?
A) describe the experiments using cow bones to discover anti-angiogenic substances. Why was this used as a source of these potential proteins?
B) describe the “accidental” discovery of a novel antiangiogenic substance because of lab contamination?
Chapter 24 Solutions
Concepts of Genetics (12th Edition)
Ch. 24 - Prob. 1NSTCh. 24 - People with a genetic condition known as...Ch. 24 - Prob. 3NSTCh. 24 - Cancer can arise spontaneously, but it can also be...Ch. 24 - Prob. 1CSCh. 24 - Prob. 2CSCh. 24 - If you agree to participate and then learn that...Ch. 24 - HOW DO WE KNOW? In this chapter, we focused on...Ch. 24 - Prob. 2PDQCh. 24 - Where are the major regulatory points in the cell...
Ch. 24 - List the functions of kinases and cyclins, and...Ch. 24 - How can mutations in noncoding segments of DNA...Ch. 24 - What is the difference between saying that cancer...Ch. 24 - Prob. 7PDQCh. 24 - Prob. 8PDQCh. 24 - Define tumor-suppressor genes. Why is a mutated...Ch. 24 - Describe the steps by which the TP53 gene responds...Ch. 24 - Part of the Ras protein is associated with the...Ch. 24 - Prob. 12PDQCh. 24 - Distinguish between oncogenes and proto-oncogenes....Ch. 24 - Prob. 14PDQCh. 24 - How do translocations such as the Philadelphia...Ch. 24 - Explain why many oncogenic viruses contain genes...Ch. 24 - Prob. 17PDQCh. 24 - How do normal cells protect themselves from...Ch. 24 - Prob. 19PDQCh. 24 - Epigenetics is a relatively new area of genetics...Ch. 24 - Radiotherapy (treatment with ionizing radiation)...Ch. 24 - Genetic tests that detect mutations in the BRCA1...Ch. 24 - Explain the apparent paradox that both...Ch. 24 - As part of a cancer research project, you have...Ch. 24 - Mutations in tumor-suppressor genes are associated...Ch. 24 - Prob. 26ESPCh. 24 - Those who inherit a mutant allele of the RB1...Ch. 24 - The table in this problem summarizes some of the...Ch. 24 - Researchers have identified some tumors that have...Ch. 24 - Prob. 30ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following chromosomal aberration is found in nearly 90-95% of all patients who have chronic myelogenous leukemia. This is because the change brings the BCR and ABL genes in close proximity. BCR is responsible for cell growth, and ABL is a proto-oncogene... this favors uncontrolled growth. Which is the most accurate description of the aberration... chio moso me 9 Philad elphia chromosome chromosome 22 BCR ABL 22q11.2 (BCR) 9934 1 (ABL) Deletion Translocation Inversion Duplication DELL O O O Carrow_forwardA research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…arrow_forwardMutational signatures of p53 are shown in this image (G.P. Pfeifer et al., Nature, 21(48), 2002) for the three types of cancer with the highest death rates in the United States: lung (~225,000 deaths in 2016), breast (246,000), and colorectal (381,000). These data can be obtained by sequencing the gene that encodes p53. Approximately 85 percent of lung cancers occur in smokers. Based on these data, calculate how many deaths due to lung cancer among nonsmokers were reported in 2016. How much does smoking increase the likelihood of death due to lung cancer?arrow_forward
- What is the Philadelphia chromosome? Briefly describe how it causes chronic myeloid leukemia.arrow_forwardFor the following diseases, describe the best technique for diagnosing them. Please make sure you include how you would tell someone with the disease from someone without the disease. B. Factor V Leiden thrombophilia is caused by a point mutation at position 1691 in exon 10 of the Factor V clotting factor gene that changes an arginine into a glutamine. This change removes one of the cleavage sites for activated protein C and leads to an increased tendency to clot.arrow_forwardUse the sequence provided here to identify the tag and tag location for the encoded DHFR fusion protein: ATATGCATCACCATCACCATCACATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAAarrow_forward
- . Mutations in an autosomal gene in humans cause aform of hemophilia called von Willebrand disease(vWD). This gene specifies a blood plasma proteincleverly called von Willebrand factor (vWF). vWFstabilizes factor VIII, a blood plasma protein specified by the wild-type hemophilia A gene. Factor VIIIis needed to form blood clots. Thus, factor VIII is rapidly destroyed in the absence of vWF.Which of the following might successfully be employed in the treatment of bleeding episodes in hemophiliac patients? Would the treatments workimmediately or only after some delay needed forprotein synthesis? Would the treatments have only ashort-term or a prolonged effect? Assume that allmutations are null (that is, the mutations result in thecomplete absence of the protein encoded by the gene)and that the plasma is cell-free.a. transfusion of plasma from normal blood into avWD patientb. transfusion of plasma from a vWD patient into adifferent vWD patientc. transfusion of plasma from a hemophilia A…arrow_forwardThe diosgenin drug (DSG) has been tested on human cholangiocarcinoma cells (bile duct cancer cells). To this aim, the human cholangiocarcinoma cell lines HuCCT1, QBC939, SK-ChA-1, HuH28, RBE, and Mz-ChA-1 have been subjected to different conditions of treatment with DSG, then assessed for their viability using a MTS assay, and their cell cycle progression using flow cytometry (FCM).Note: The MTS assay is based on the reduction of the MTS tetrazolium compound by viable cells to generate a colored formazan dye that is soluble in cell culture media. This conversion is thoughtto be carried out by NAD(P)H-dependent dehydrogenase enzymes in metabolically active cells.The formazan dye is quantified by measuring its absorbance at 490-500 nm. Question : To which kind of biological molecule does this DSG drug resemble? To which kind of properties do you expect for DSG?arrow_forwardBased on the sensitivity of DNA to DNase I, as illustrated in Figure , which type of chicken hemoglobin (embryonic or adult) is likely to be produced in the highest quantity in the following tissues and developmental stages? Q. Erythroblasts at day 5arrow_forward
- Below is a figure (here called Figure 1) from “Prognostic Significance of CpG Island Methylator Phenotype and Microsatellite Instability in Gastric Carcinoma,” by An et al., published in Clinical Cancer Research in 2005. The authors look at five microsatellite loci (BAT 25, BAT 26, D2S123, D5S346, and D17S250) in normal (N) and tumor (T) tissue from patients with Gastric Carcinoma. They amplify the loci by PCR and then instead of using standard agarose gel electrophoresis, they run the PCR products through capillary gel electrophoresis and detect bands as they pass a laser near the positive charge terminal. The x-axis in these plots is the time at which the band passed the laser (aka size of the PCR product) and the intensity of the peaks represents the amount of DNA in that band A. Which patient- 18, 30, or 1- shows the most microsatellite instability? Which patient shows the least? How do you know? B. In which repair pathway is it most likely that you will find the driver mutations…arrow_forwardHow do loss of function mutations associated with Artemis (protein) cause their resulting phenotypes? Explain how genetically modified HSCs can treat these phenotypes.arrow_forwardExplain how hematopoietic stem cells were experimentally shown to be both multipotent and capable of self-renewal.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Cancer Types SIMPLY explained! MEMORIZE them QUICKLY and EASILY!; Author: CancerEdInstitute;https://www.youtube.com/watch?v=dEBi-yvSWmQ;License: Standard Youtube License