Campbell Biology
12th Edition
ISBN: 9780135188743
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 20, Problem 6TYU
Expression of a cloned eukaryotic gene in a bacterial cell involves many challenges. The use of mRNA and reverse transcriptase is part of a strategy to solve the problm of
- (A) post -transcriptional processing.
- (B) post-translational processing.
- (C)
nucleic acid hybridization. - (D) restriction fragment ligation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A) Outline the experimental procedure for cloning a eukaryotic gene and expressing it in
E. coli. Focus on the essential steps starting with eukaryotic gene amplification to
transformation of E. coli cells
B) Explain how insertional inactivation can help you identify the colonies that carry
the plasmid with your eukaryotic gene of interest
C) Plasmids containing antibiotic resistance genes are widely used in gene cloning and
other molecular biology techniques. What would happen if the eukaryotic gene was inserted into
an antibiotic resistance gene on the plasmid?
Bacteriophage lambda is as one of the routinely used molecular cloning vectors, which alsoserved as a model system for the study of bacteriophage morphogenesis, DNA replication, andgene regulation.a) With the aid of a diagram, generally narrate how a foreign gene can be inserted into alambda insertion vector and subsequently infect an Escherichia coli cell.b) You are cloning a 7.5 kb gene into a lambda gt10 vector, utilizing a restriction site whichspecifically present in the vector. State the restriction site that you can use for this purposeand suggest a screening procedure to indicate successful integration of the gene into thehost genome.
A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained.
(a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?
Chapter 20 Solutions
Campbell Biology
Ch. 20.1 - Prob. 1CCCh. 20.1 - DRAW IT One Strand of a DNA molecule has the...Ch. 20.1 - What are some potential difficulties in using...Ch. 20.1 - VISUAL SKILLS Compare Figure 20.7 with Figure...Ch. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.3 - Based on current knowledge, how would you explain...Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.4 - What is the advantage of using stem cells for gene...
Ch. 20.4 - Prob. 2CCCh. 20.4 - Prob. 3CCCh. 20 - Describe how the process of gene doning results in...Ch. 20 - What useful Information is obtained by detecting...Ch. 20 - Describe how, using mice. a researcher could carry...Ch. 20 - What factors affecf whether a given genetic...Ch. 20 - In DNA technology, the term vector can refer to...Ch. 20 - Which of the following tools of DNA technology is...Ch. 20 - Prob. 3TYUCh. 20 - A paleontologist has recovered a bit of tissue...Ch. 20 - Which of the following is not true of cDNA...Ch. 20 - Expression of a cloned eukaryotic gene in a...Ch. 20 - Which Ii of the following sequences in...Ch. 20 - Prob. 8TYUCh. 20 - MAKE CONNECTIONS Looking at Figure 20.15, what...Ch. 20 - DRAW IT You are cloning an aardvark gene, using a...Ch. 20 - EVOLUTlON CONNECTION Ethical considerations aside,...Ch. 20 - Prob. 12TYUCh. 20 - Prob. 13TYUCh. 20 - Prob. 14TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (5th Edition)
A student moving out of a dormitory crouches in correct fashion to lift a heavy box of books. What prime movers...
HUMAN ANATOMY
What is the difference between histology and radiography?
Human Anatomy (8th Edition)
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Codon optimization is a widely used process for recombinant expression in prokaryotic systems. Regarding this process, mark the incorrect alternative. * A)increases the overall yield of expression of recombinant proteins. B)prevents the formation of truncated proteins. C)increases the frequency of tRNAs that recognize rare codons. D)does not interfere with the primary sequence of the recombinant protein.arrow_forwardThe E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.arrow_forwardQ.) A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give examples? B.)aminoacyl tRNA synthetase is specialized or not ? And why?arrow_forward
- 1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and Bcll. a) Shown below is a BamHI recognition site, which cleaves after the first G. Does cleavage by BamHI result in a 5' or 3' overhang? 5... GGATCC...3' 3...CCTAGG...5' b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by , Bcll result in a 5' or 3' overhang? 5... TGATCA...3' 3'... ACTAGT.. 5' You are given the DNA shown below. 5 ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. d) If the above DNA was cut with Bcll, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. e) If you ligate or join the smaller restriction fragment in step c with the smaller restriction fragment in step d, what…arrow_forwardThe plasmids from the pUC series are created in the University of California. They carry a lacz gene that plays a significant role in the screening process after transformation. (i) Name the screening process utilizing the lacZ gene. (ii) Elaborate how this gene plays a crucial role in the screening step as mentioned above.arrow_forward1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHl and Bcll. a) Shown below is a BamHI recognition site, which cleaves after the first G. Does cleavage by BamHl result in a 5' or 3' overhang? 5... G'GATCC...3 3...CCTAGG...5 b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by Bcll result in a 5' or 3' overhang? 5... TGATCA...3 3... ACTAGT...5 You are given the DNA shown below. 5' ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. d) If the above DNA was cut with Bcll, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. e) If you ligate or join the smaller restriction fragment in step c with the smaller restriction fragment in step d, what would…arrow_forward
- What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.arrow_forwardIn generating mutations in a bacterial gene involved in antibiotic resistance, a number of point mutations are isolated that render the bacteria sensitive to the antibiotic. You would like to sequence the gene in order to characterize the mutations, but unfortunately, your lab partner just finished the last of the lab's supply of DNA polymerase. The only things at your disposal are materials for performing a western blot, allowing you to visualize the protein encoded by the gene. How would you identify which mutations are likely to be the result of a missense mutation, which are likely to be the result of a nonsense mutation, and which are likely to be the result of a frameshift mutation?arrow_forwardIt is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation. a) List all the steps from cell pellet preparation to DNA elution. b) With which feature can the membrane in the column that comes with the commercial kit bind DNA? c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?arrow_forward
- Mutagenesis is a technique in which genetic information of an organism is altered in a stable manner resulting in a mutation. It may occur spontaneously in nature of as a result of exposure to mutagens. It can also be achieved experimentally using optimized laboratory procedures. (i) (ii) What is site directed mutagenesis (SDM)? Explain how SDM can assist in the integration of a His-tag at the end of your gene of interest.arrow_forwardA full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter sequence and a functional polyadenylation sequence, and it has wild-type nucleotides throughout the transcribed region. However, the gene fails to produce a functional protein. a)List at least 3 possible reasons why this eukaryotic gene is not expressed in bacteria. b)What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?arrow_forwardYou isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License