Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and Bcll. a) Shown below is a BamHI recognition site, which cleaves after the first G. Does cleavage by BamHI result in a 5' or 3' overhang? 1. 5... GGATCC...3' 3'...CCTAGG...5' b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by , Bcll result in a 5' or 3' overhang? 5... TGATCA...3 3'... ACTAGT...5' You are given the DNA shown below. 5' ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHl, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. d) If the above DNA was cut with Bcll, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. e) If you ligate or join the smaller restriction fragment in step c with the smaller restriction fragment in step d, what would be the sequence of the resulting recombinant DNA fragment? f) Could you cut this recombinant DNA fragment with either BamH1 or Bcll? Yes or No, explain briefly.

Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and Bcll. a) Shown below is a BamHI recognition site, which cleaves after the first G. Does cleavage by BamHI result in a 5' or 3' overhang? 1. 5... GGATCC...3' 3'...CCTAGG...5' b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by , Bcll result in a 5' or 3' overhang? 5... TGATCA...3 3'... ACTAGT...5' You are given the DNA shown below. 5' ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHl, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. d) If the above DNA was cut with Bcll, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. e) If you ligate or join the smaller restriction fragment in step c with the smaller restriction fragment in step d, what would be the sequence of the resulting recombinant DNA fragment? f) Could you cut this recombinant DNA fragment with either BamH1 or Bcll? Yes or No, explain briefly.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The restriction enzyme Haelll has the recognition sequence below and cuts between the G and C bases. 5'...GG'CC...3' 3...CC'GG...5' Determine the number of fragments that would be produced with the following sequence. 5'-ATTGCGCTCAAAGGCCAATCATCAGGTTC-3' 3'-TAACGCGAGTTTCCGGTTAGTAGTCCAAG-5' O 1 O 2 O 3 O 4 MacBook Pr
#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?
8. A mutant that has a nutritional requirement for growth is an example of a(n) A) heterotroph B) auxotroph C) autotroph D) organotroph 9. In the Ames test the number of histidine auxotroph colonies growing on media lacking histidine when exposed to a potential chemical mutagen is. proportional to the likelihood that the chemical is mutagenic. A) Directly B) Inversely 10. Thymine dimers result from A) ionizing radiation B) nucleoside analogs C) non-ionizing radiation D) none of the above 12. RecA proteins are NOT required for homologous recombination? A) True B) False 13. Increasing genetic variability by the uptake of DNA from the environment is A) transduction B) transformation C) a mutation D) conjugation 14. Which of the following features are common to transformation, transduction, and conjugation? (1) unidirectional transfer of genes (2) incomplete gene transfer (3) homologous recombination (4) meiosis occurring in the recipient A) 1, 2, 4 B) 1, 2, 3 C) 3,4 D) 1,2 15. What is…
1. Explain how the SNP changes the recognition sequence for the restriction enzyme and affects its ability to cut the DNA. Indicate which of the 2 alleles (taster or non-taster) is cut by the restriction enzyme. 2. Predict the size of the expected DNA fragments after restriction digest for the two alternative SNP sequences (the taster and the non-taster).i.) Taster allele after being cut ii.) Non-taster allele after being cut
9. The restriction site sequence for the restriction enzyme Sau3Al and BamHI include four identical bases, making their sticky ends identical as shown in the figure. Let's say you have foreign DNA whose flanking regions were cut with Sau3AI. Also, you want to use a plasmid containing a BamHI restriction site. (1) Would it be possible to ligate the foreign DNA into the BamHI site of the plasmid? Explain. lison Lenharc (2) Would it be possible to cut the ligated sites with Sau3AI? What about BamHI? What problems will you expect if you use BamHI? BamHI Sau3Al G-G-A-T-C-C பர்டிய C-C-T-A-G-G G-A-T-C Hi- 目1目 C-T-A-G C-C-T-A-G C-T-A-G G-A-T-C-C E E G-A-T-C= 10. An ampicillin-resistant, tetracycline-resistant plasmid, pBR322, is cut with Pstl, which cleaves within the ampi resistance gene. The cut plasmid is ligated with Pstl digested Drosophila DNA to prepare a genomic library, and t rcoli K12
1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The number in parenthesis shows the position of the cleavage site. The total length of the DNA fragment is 4000 bp. Small parts of the DNA sequence is known as shown. 5' ACCCTAGGTGTGACCGCGATCCGGCAGCATAAT 3' EcoRI (400) EcoRI (1300) EcoRI (3800) 3' CGCGAAATGCTTTAAGCGCTCTACGGGAGGG5' 3'AGCGTTAGAGTAGCCGGTAAAGGGTACGCGCCTTAA 5' Figure 1: DNA fragment with a total length of 4000 bp. The figure below depicts a gel on which marker DNA of known size has been run. Sketch the location of the bands that will appear, if the DNA fragment shown in Figure 1 is cleaved by EcoRI and afterwards run on the gel along with the marker DNA. 6000 5000 4000 3000 2000 1000 800 600 500 400 200
2. You are planning to clone a gene into the PBR322 plasmid vector. The gene has Bgl II restriction enzyme sites on both the 5' and 3' ends. Restriction enzyme Recognition site 5'... CTGCAG...3' 3... GACGTC... 5 5... GAATTC...3' 3:... CTTAAG. ECORI Hindil Pst I BamH Eco RI 5' Tetracycline Resistance Hind III 5...AAGCTT...3' PBR322 (4.36 kb) Xmalll 3...TTCGAA ... 5' 5... GGATCC...3' 3... CCTAGG...5' 5...CCCGGG...3° 3...GGGCCC ... 5 5... A'G ATCT...3 3... TCTAGA... 51 Bam HI Origin Replication Xma l BglI E. coli PBR322 plasmid showing restriction sites and resistance genes. Pvull With which restriction enzyme would you cut the PBR322 plasmid vector? Give a reason for your answer. You assemble a ligation reaction to join the gene to the plasmid DNA. What types of product would you expect to obtain from the ligation reaction? Please consider the selection marker genes, Ampicillin resistance gene and Tetracycline resistance gene. What would the antibiotic resistance phenotype be of a…
The following diagram shows one-half of a restriction site. (a) Draw the other half. GAC G I C (b) Use heavy arrows (↑1) to identify type II cleavage sites that would yield blunt-ended duplex DNA products. (c) Use light arrows (T1) to identify type II cleavage sites yielding staggered cuts that could be converted directly to recombinant DNA molecules by DNA ligase, with no other enzymes involved. (d) If this were the recognition site for a type I restriction endonu- clease, where would cutting of the duplex occur? (e) If DNA sequences were completely random, how large an inter- val (in kilobase pairs) would you expect between identical copies of this sequence in DNA?
1. A DNA sequence 10 kb long contains one site at which it may be cut by the restriction enzyme Pstl. The same 10 kb long sequence also contains one site that can be cut by restriction enzyme Bg/II. Three separate fractions of this DNA were treated separately, as follows: 1) digestion by Pstl; 2) digestion by Bg/II; 3) digestion by both enzymes. The three treated fractions were then subjected to gel electrophoresis. The following table shows the lengths of the restriction fragments associated with each treated fraction. From the result, draw a restriction map that shows the Pst and the Bg/II cutting sites in the 10 kb DNA. Enzyme in mixture Pstl BgIII Pstl and BgIII Fragment Lengths (kb) 6.4 and 3.6 8.8 and 1.2 5.2, 3.6 and 1.2
6. Mutation analysis of GCK gene in patients with diabetes revealed a c.114 TàA (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) (5p) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) (10p) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGC ATGGCAGCTCTAATGACAGGATGGTCACCCCTG CTGAGGCCACTCCTGGTCACCATGACAACCACA GGCCCTCTCAGTATCACAGTAAGCCCTGGCAGG AGAATCCCCCACTCCACACCTGGCTGGAGCACG AAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGC AGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme|Recognition sequence GG/CGCC Nar…
1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizes
A). Briefly describe the function of telomerase. B). How does the structure of telomerase allow it to complete the function you described?