Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 2, Problem 2.9PS
TMV Assembly. Each of these statements is an experimental observation concerning the reassembly of tobacco mosaic virus (TMV) virions from TMV RNA and coat protein subunits. In each case, carefully state a reasonable conclusion that can be drawn from the experimental finding.
(a) When RNA from a specific strain of TMV is mixed with coat protein from the same strain, infectious virions are formed.
(b) When RNA from strain A of TMV is mixed with coat protein from strain B, the reassembled virions are infectious, giving rise to strain A virus particles in the infected tobacco cells.
(c) Isolated coat protein monomers can
(d) In infected plant cells, the TMV virions that form contain only TMV RNA and never any of the various kinds of cellular RNAs present in the host cell.
(e) Regardless of the ratio of RNA to coat protein in the starting mixture, the reassembled virions always contain RNA and coat protein in the ratio of three
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
True or False.
1. a.) RNA polymerase decodes mRNA so the ribosome can make proteins.
b.) Only coding RNA can interact with the ribosome.
c.) The ribosome is composed of both protein and ncRNA.
d.)The ncRNA components of the ribosome behave as a ribozyme.
Pick one of the FALSE statements from the 4 previous questions and explain why it is incorrect.
A cytosine is deaminated. Describe the outcome of this deamination and explain in detail how E. coli repairs this mutation using base excision repair (BER). This repair should contain 5 steps and describe the function of all enzymes or structures.
true or false
1.) The unique stem-loop structures of the transfer RNA helps the RNA perform its function of joining ribosomal proteins to form the sites for protein synthesis.
2.) DNA molecules can perform their function in replication and transcription as long as the 2 strands remain intact and not separated.
3.) Histone proteins are able to associate with DNA segments because of the anionic nature of the amino acids arg and lys.
4.) The long solenoid structure of the chromatin material binds to a protein scaffold and folds further to form the chromatin/chromosome structure.
5.) Primary amines and keto groups of the nitrogen bases are involved in base-pairing in double stranded DNA.
Chapter 2 Solutions
Becker's World of the Cell (9th Edition)
Ch. 2 - What properties of the carbon atom make it...Ch. 2 - QUESTION: Compare the flights of the ionized...Ch. 2 - How would the properties of water change if the...Ch. 2 - Why is the amphipathic nature of membrane...Ch. 2 - Problem Set CONCEPT CHECK 2.4 What characteristics...Ch. 2 - Problem Set CONCEPT CHECK 2.5 TMV is an...Ch. 2 - The Fitness of Carbon. Each of the properties that...Ch. 2 - The Fitness of Water. For each of these statements...Ch. 2 - Wrong Again. For each of the following false...Ch. 2 - Prob. 2.4PS
Ch. 2 - Drug Targeting. Your company has developed a new...Ch. 2 - Its All About Membranes. Answer each of the...Ch. 2 - The Polarity of Water. Defend the assertion that...Ch. 2 - QUANTITATIVE Bond Energies. A single covalent bond...Ch. 2 - TMV Assembly. Each of these statements is an...Ch. 2 - Mars Is Alive? Imagine this futuristic scenario:...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- .A protein gives a single band on SDS gel electrophoresis, as shown in lanes 1 and 2 below. There is little if any effect from addingarrow_forwardplease help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.arrow_forwardBroken operators. Consider a hypothetical mutation in OR2OR 2 that blocks both A repressor and Cro binding. How would this mutation affect the likelihood of bacteriophage entering the lytic phase?arrow_forward
- . Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.arrow_forwardPlease do answer all the questions. I'll definitely give a like You discovered a halophilic bacterium and want to characterize the mechanism involved in producing mature tRNA molecules from larger tRNA precursors. You isolated a large complex composed of a protein component and an RNA component that is capable of cleaving the larger tRNA precursor. To determine which one of the two components is responsible for catalysis, you perform an in vitro tRNA cleavage assay in the proper buffer conditions, including a low concentration of Mg2+ and 0.5 M bovine serum albumin (BSA). BSA is not specific for this reaction. The table below summarizes the results after performing eight separate reactions. The + symbol indicates the included reaction components. Q. Based on the results obtained, what can you conclude about the composition of the biological catalyst required for the maturation of tRNA? Q. Indicate which reactions helped you make your conclusion. Why? Q. Which reactions allowed you…arrow_forwardUsing Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.arrow_forward
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardtransformation and CRISPR. In your own words, briefly describe two differences between these technologies. (For example, these can be differences between their outcomes, procedures, reagents, or something else.)arrow_forwardCell wall bullding block D-Ala-D-Alal-Lys-tail NH,Me Heptapeptide backbone R1 R. R2 ii) With the aid of the figure above showing the important features of the binding of Vancomycin (lower part) to a bacterial cell wall peptia discuss the antibiotic effect of Vancomycin. i) Vancomycin resistant strains often have a mutation in which one of the D-Ala moieties is exchanged to a D-lactate moiety. Discuss why this mutation makes the strain Vancomycin- resistant but still viable. iv) Glycoconjugate vaccines based on bacterial capsular polysaccharides have been used for 30 years without any need for changes in their structures, while the flu vaccine, based on attenuated or killed virus particles, requires many different structures and a check each time when there is an epidemic that the right vaccine is used. Discuss the reason behind this.arrow_forward
- True or False 1.) The bonds linking bases and sugars are covalent. 2.) The structure of the transfer RNA assumes a more 3-dimensional structure because of the hydrogen bonding in far apart bases in the structure.arrow_forwardgene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forwardProvide a brief description behind your choice? Virus-mediated transfer of cellular genetic material from one bacterial cell to another by means of virus particles is called: (A) transduction (B) transposition (C) transformation (D) transfection One strand of double-stranded DNA is mutated, changing all cytosines to uracils. After one round of replication of the mutated DNA strand, the melting temperature of the resulting DNA will: (A) be higher (B) be lower (C) remain the same (D) be double The Southern blotting technique is used for: (A) the detection of RNA fragments onmembranes by specific radioactiveantibodies (B) the detection of DNA fragments onmembranes by a radioactive DNAprobe (C) the detection of proteins on membranesusing a radioactive DNA probe (D) the detection of DNA fragments onmembranes by specific radioactiveantibodies Superoxide dismutase is an important enzyme for maintenance of red blood cells and is defective insome neurodegenerative diseases. What…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license