Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 19, Problem 19.7PS
(a)
Summary Introduction
To explain: The step in polypeptide synthesis inhibited by Rambomycin.
Introduction: The polypeptide chain refers to the sequence of amino acids which are linked with the help of peptide bonds. The process of polypeptide synthesis refers to the generation of peptides. The polypeptide synthesis is carried out with the help of translation and transcription.
(b)
Summary Introduction
To determine: Whether the oligonucleotide product be attached to tRNA at the end of the uninhibited reaction and will the dipeptide product be attached to tRNA at the end of Rambomycin-inhibited reaction.
Introduction: The polypeptide chain refers to the sequence of amino acids which are linked with the help of peptide bonds. The process of polypeptide synthesis refers to the generation of peptides. The polypeptide synthesis is carried out with the help of translation and transcription.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Original sequence:
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):
5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’
Question:
4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this?
5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
e.) (
acid buffer an appropriate choice? Why or why not?
If I need to perform an enzymatic reaction at pH 6.5, is a citric
)Describe the process of transcription in as much detail as
possible using pictures and words beginning with a paired (duplexed) strand
of DNA and ending with a processed mRNA which is ready for translation.
7.
AAAGAGAAAAGAAUA
to AAAGAGAAAUGAAUA.
Suppose the codon sequence
has a single base pair mutation
If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene?
(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.)
Submit Answer
Retry Entire Group No more group attempts remain
Chapter 19 Solutions
Becker's World of the Cell (9th Edition)
Ch. 19 - Suppose a tRNA has the anticodon 3-CGU-5. What two...Ch. 19 - Kanamycin is an antibiotic that binds to bacterial...Ch. 19 - You are working in a lab to identify new alleles...Ch. 19 - Suppose you are using GFP fusion proteins to study...Ch. 19 - Enzymes can undergo allosteric regulation or...Ch. 19 - Suppose you use molecular biology techniques to...Ch. 19 - Prob. 19.1PSCh. 19 - Tracking a Series of Mutations. The following...Ch. 19 - Prob. 19.3PSCh. 19 - Prob. 19.4PS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- proteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.arrow_forwardE. coli ribonuclease H1 is an enzyme that catalyzes the hydrolysis of phosphodiester bonds in RNA. Its proposed mechanism involves a 'carboxylate relay,' as shown below. His124 Asp70 || -HN-CH-C -HN-CH-C- CH2 CH2 c=0 RNA substrate HN H. H. (1) Fill the blanks. In the reaction scheme above, His124 acts as a ( ). The purpose of this relay system is to deprotonate the water molecule (II) so that it becomes a better ( :0arrow_forwardSmall molecules are used as inhibitors of protein action - as drugs. They most often do this by blocking the active site within the protein. Potential drugs can be screened computationally to determine if they are strongly bound to the protein. Figure 1 shows a possible conformation of a candidate drug molecule, 4-bromo-2- carboxymethylamide-pyrrole (abbreviation: BCMAP) at the active site of a protein (abbreviation: PR). Figure 2 shows the full protein structure whilst figure 3 shows a known inhibitor of the protein at the site, overlayed with another calculated conformer of BCMAP. (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein in competition with the molecules that the protein normally targets, and any solvent. Figure 1. 4-bromo-2-carboxymethylamide-pyrrole (BCMAP) (C, N, O, and Br atoms in yellow, blue, red, and brown, respectively) in the active site of the protein structure.arrow_forward
- Suggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.arrow_forwardAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forwardAffinity chromatography You have created a fusion protein tagged with Glutathione-S-Transferase (GST). Your lab mate tells you that the affinity columns for this type of tagged protein are very similar to that of Histadine tagged proteins. Using the following elements set up a purification column and construct a protocol for an affinity purification using this tag. A large amount of glutathione is usually used to elute the tagged protein off the column. How might this work?arrow_forward
- Initiation. Bacterial protein synthesis is initiated by: a. S-adenosylmethionyl tRNA b. Methionyl TRNA c. N-formylmethionyl tRNA d. N10-formyltetrahydrofolateN"-formyltetrahydrofolate †RNA „N10arrow_forwardE Threonine 6. You have identified some intermediates in threonine synthesis: A, B, C, D and E. You grow a few of your mutants in the presence of these different intermediates to determine the order in which the gene products act. Below are your results. A (+) means growth and a (-) means no growth. Given these data, draw the best possible pathway for the synthesis of threonine. The diagram should use arrows to indicate one intermediate being changed to another intermediate. Indicate which gene produces the product responsible for the conversion by listing the mutant in that gene above the arrow. Mt1 Mt2 Mt4 Mt7arrow_forwardEquilibrium constants are always dependent upon temperature. In determining equilibrium constants for biochemical reactions the equilibrium constant also depends upon ion concentration and proton concentration. Write down an equation in differential form that describe the dependence of an equilibrium constant K for a protein binding to DNA, where the equilibrium constant, K is a function of Temperature, [NaCI], and [H*], i.e. dK(T, [NaCl], [H*]).arrow_forward
- Why Dil. naOH is very soluble in yeast rna?arrow_forward. Give two reasons to explain why a proline residue in the middle of an ahelix is predicted to be destabilizing to the helical structurearrow_forwardUsing Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license