The possible RNA molecules from the given human DNA. Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

Question

Want to see the full answer?

Answer 1

Question

Chapter 19, Problem 19.1PS

(a)

Summary Introduction

To determine: The possible RNA molecules from the given human DNA.

Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

(b)

Summary Introduction

To explain: The translation of only one out of two RNA molecules.

Introduction: In the process of translation, the synthesis of proteins occurs with the help of ribosomes or endoplasmic reticulum. The translation process has three phases which include initiation, elongation, and termination.

(c)

Summary Introduction

To determine: The amino acid sequence for vasopressin if the RNA molecule that can be translated is mRNA for hormone vasopressin.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

(d)

Summary Introduction

To explain: The vasopressin in its active form is nonapeptide with cysteine at the N-terminus.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

(e)

Summary Introduction

To determine: The way to change DNA that encodes vasopressin to encode for oxytocin and also suggest the evolutionary relationship between genes for vasopressin and oxytocin or not.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The 2 subunits of DNA PoI II are called clamp loader and sliding clamps. 2. In eukaryotes, replication and transcription occur in the nucleus, while translation occurs in the cytoplasm.

Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3

AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remain

Answer 2

Question

Chapter 19, Problem 19.1PS

(a)

Summary Introduction

To determine: The possible RNA molecules from the given human DNA.

Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

(b)

Summary Introduction

To explain: The translation of only one out of two RNA molecules.

Introduction: In the process of translation, the synthesis of proteins occurs with the help of ribosomes or endoplasmic reticulum. The translation process has three phases which include initiation, elongation, and termination.

(c)

Summary Introduction

To determine: The amino acid sequence for vasopressin if the RNA molecule that can be translated is mRNA for hormone vasopressin.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

(d)

Summary Introduction

To explain: The vasopressin in its active form is nonapeptide with cysteine at the N-terminus.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

(e)

Summary Introduction

To determine: The way to change DNA that encodes vasopressin to encode for oxytocin and also suggest the evolutionary relationship between genes for vasopressin and oxytocin or not.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 19, Problem 19.1PS

(a)

Summary Introduction

To determine: The possible RNA molecules from the given human DNA.

Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

(b)

Summary Introduction

To explain: The translation of only one out of two RNA molecules.

Introduction: In the process of translation, the synthesis of proteins occurs with the help of ribosomes or endoplasmic reticulum. The translation process has three phases which include initiation, elongation, and termination.

(c)

Summary Introduction

To determine: The amino acid sequence for vasopressin if the RNA molecule that can be translated is mRNA for hormone vasopressin.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

(d)

Summary Introduction

To explain: The vasopressin in its active form is nonapeptide with cysteine at the N-terminus.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

(e)

Summary Introduction

To determine: The way to change DNA that encodes vasopressin to encode for oxytocin and also suggest the evolutionary relationship between genes for vasopressin and oxytocin or not.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 19, Problem 19.1PS

(a)

Summary Introduction

To determine: The possible RNA molecules from the given human DNA.

Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

(b)

Summary Introduction

To explain: The translation of only one out of two RNA molecules.

Introduction: In the process of translation, the synthesis of proteins occurs with the help of ribosomes or endoplasmic reticulum. The translation process has three phases which include initiation, elongation, and termination.

(c)

Summary Introduction

To determine: The amino acid sequence for vasopressin if the RNA molecule that can be translated is mRNA for hormone vasopressin.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

(d)

Summary Introduction

To explain: The vasopressin in its active form is nonapeptide with cysteine at the N-terminus.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

(e)

Summary Introduction

To determine: The way to change DNA that encodes vasopressin to encode for oxytocin and also suggest the evolutionary relationship between genes for vasopressin and oxytocin or not.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 19, Problem 19.1PS

(a)

Summary Introduction

To determine: The possible RNA molecules from the given human DNA.

Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

(b)

Summary Introduction

To explain: The translation of only one out of two RNA molecules.

Introduction: In the process of translation, the synthesis of proteins occurs with the help of ribosomes or endoplasmic reticulum. The translation process has three phases which include initiation, elongation, and termination.

(c)

Summary Introduction

To determine: The amino acid sequence for vasopressin if the RNA molecule that can be translated is mRNA for hormone vasopressin.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

(d)

Summary Introduction

To explain: The vasopressin in its active form is nonapeptide with cysteine at the N-terminus.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

(e)

Summary Introduction

To determine: The way to change DNA that encodes vasopressin to encode for oxytocin and also suggest the evolutionary relationship between genes for vasopressin and oxytocin or not.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Answer 6

Chapter 19, Problem 19.1PS

(a)

Summary Introduction

To determine: The possible RNA molecules from the given human DNA.

Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

Answer 7

Chapter 19, Problem 19.1PS

(a)

Summary Introduction

To determine: The possible RNA molecules from the given human DNA.

Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

Answer 8

(b)

Summary Introduction

To explain: The translation of only one out of two RNA molecules.

Introduction: In the process of translation, the synthesis of proteins occurs with the help of ribosomes or endoplasmic reticulum. The translation process has three phases which include initiation, elongation, and termination.

Answer 9

(b)

Summary Introduction

To explain: The translation of only one out of two RNA molecules.

Introduction: In the process of translation, the synthesis of proteins occurs with the help of ribosomes or endoplasmic reticulum. The translation process has three phases which include initiation, elongation, and termination.

Answer 10

(c)

Summary Introduction

To determine: The amino acid sequence for vasopressin if the RNA molecule that can be translated is mRNA for hormone vasopressin.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Answer 11

(c)

Summary Introduction

To determine: The amino acid sequence for vasopressin if the RNA molecule that can be translated is mRNA for hormone vasopressin.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Answer 12

(d)

Summary Introduction

To explain: The vasopressin in its active form is nonapeptide with cysteine at the N-terminus.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Answer 13

(d)

Summary Introduction

To explain: The vasopressin in its active form is nonapeptide with cysteine at the N-terminus.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Answer 14

(e)

Summary Introduction

To determine: The way to change DNA that encodes vasopressin to encode for oxytocin and also suggest the evolutionary relationship between genes for vasopressin and oxytocin or not.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Answer 15

(e)

Summary Introduction

To determine: The way to change DNA that encodes vasopressin to encode for oxytocin and also suggest the evolutionary relationship between genes for vasopressin and oxytocin or not.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Answer 16

Expert Solution & Answer

Answer 17

Expert Solution & Answer

Answer 18

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 19

Ch. 19 - Suppose a tRNA has the anticodon 3-CGU-5. What two...Ch. 19 - Kanamycin is an antibiotic that binds to bacterial...Ch. 19 - You are working in a lab to identify new alleles...Ch. 19 - Suppose you are using GFP fusion proteins to study...Ch. 19 - Enzymes can undergo allosteric regulation or...Ch. 19 - Suppose you use molecular biology techniques to...Ch. 19 - Prob. 19.1PS Ch. 19 - Tracking a Series of Mutations. The following...Ch. 19 - Prob. 19.3PS Ch. 19 - Prob. 19.4PS

The possible RNA molecules from the given human DNA. Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

Solution Summary: The author explains the translation of only one out of two RNA molecules.

Concept explainers

Videos

To determine: The possible RNA molecules from the given human DNA.

Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

To explain: The translation of only one out of two RNA molecules.

Introduction: In the process of translation, the synthesis of proteins occurs with the help of ribosomes or endoplasmic reticulum. The translation process has three phases which include initiation, elongation, and termination.

To explain: The vasopressin in its active form is nonapeptide with cysteine at the N-terminus.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Want to see the full answer?

Chapter 19 Solutions

The possible RNA molecules from the given human DNA. Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

Solution Summary: The author explains the translation of only one out of two RNA molecules.

Concept explainers

Videos

To determine: The possible RNA molecules from the given human DNA. Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

To explain: The translation of only one out of two RNA molecules. Introduction: In the process of translation, the synthesis of proteins occurs with the help of ribosomes or endoplasmic reticulum. The translation process has three phases which include initiation, elongation, and termination.

To explain: The vasopressin in its active form is nonapeptide with cysteine at the N-terminus. Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.

Want to see the full answer?

Chapter 19 Solutions

To determine: The possible RNA molecules from the given human DNA.

Introduction: DNA or deoxyribonucleic acid can be defined as a molecule consisting of all the genetic information. It is comprised of two chains which coil to form a double helix structure.

To explain: The translation of only one out of two RNA molecules.

Introduction: In the process of translation, the synthesis of proteins occurs with the help of ribosomes or endoplasmic reticulum. The translation process has three phases which include initiation, elongation, and termination.

To explain: The vasopressin in its active form is nonapeptide with cysteine at the N-terminus.

Introduction: Vasopressin is an antidiuretic hormone and is released from the pituitary gland. In the body, this hormone is responsible for the regulation of water balance in the blood.