Concept explainers
(a)
To explain: The result that when puromycin is added to a cell-free system containing all the necessary machinery for protein synthesis, incomplete polypeptide chains are released from the ribosomes.
Introduction: Puromycin is an antibiotic obtained from Streptomyces alboniger. This is primarily involved in the inhibition of protein synthesis. It is an inhibitor of translation in both the cells of prokaryotic and eukaryotic organisms.
(b)
To determine: The polypeptide chain end to which the puromycin will be attached.
Introduction: Puromycin is an antibiotic obtained from Streptomyces alboniger. This is primarily involved in the inhibition of protein synthesis. It is an inhibitor of translation in both the cells of prokaryotic and eukaryotic organisms.
(c)
To determine: The puromycin will bind to A or P site on the ribosome or to both..
Introduction: Puromycin is an antibiotic obtained from Streptomyces alboniger. This is primarily involved in the inhibition of protein synthesis. It is an inhibitor of translation in both the cells of prokaryotic and eukaryotic organisms.
(d)
To explain: If puromycin is a better inhibitor of protein synthesis in eukaryotes or bacteria.
Introduction: Puromycin is an antibiotic obtained from Streptomyces alboniger. This is primarily involved in the inhibition of protein synthesis. It is an inhibitor of translation in both the cells of prokaryotic and eukaryotic organisms.
Want to see the full answer?
Check out a sample textbook solutionChapter 19 Solutions
Becker's World of the Cell (9th Edition)
- tRNA enzyme. Any given aminoacyl-tRNA synthetase: a. Attaches the amino acid to the 5′-end '5end of the tRNA b. Always recognizes only one specific tRNA c. Recognizes all tRNA molecules d. Forms an ester linkage between the amino acid and the tRNAarrow_forwardInitiation. Bacterial protein synthesis is initiated by: a. S-adenosylmethionyl tRNA b. Methionyl TRNA c. N-formylmethionyl tRNA d. N10-formyltetrahydrofolateN"-formyltetrahydrofolate †RNA „N10arrow_forwardBe sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А Аarrow_forward
- Leaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the methionine residue that begins the protein. What is unusual about this beginning? Would it cause the MRNA to translate efficiently or not?arrow_forwardPolymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- proteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.arrow_forwardTranscription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNAarrow_forwardComplements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forward
- Please help me with this question. How many amino acid residues are in the heavy and light chains of the Fab fragment, and how many amino acid residues are in lysozyme?arrow_forwardDescribe translation. What is the function of the aminoacyl-tRNA synthase?arrow_forwardMatch the concepts with their definitions or examples. Match each item to a choice: DNA gyrase histones nucleosome hydrogen bonding serine ribose,2-deoxyribose N-terminal to C-terminal TRNA synthetase cysteine 5' to 3' Choices: : amino acid coded by UCG : direction of DNA synthesis ! enzyme that attaches amino acid to tRNA : direction of protein synthesis : amino acid coded by UGC : chemical bond that holds the double stranded DNA together i protein associated with DNA during supercoiling # structure formed when a DNA strand winds itself around basic protein : relieves the strain brought by DNA supercoiling : compound that serves as the basis of the 5' and 3' designationarrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning