Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 17.3PS
More
(a) Neither of the two DNA polymerases of F. mungus appears to have an exonuclease activity.
(b) Replicating DNA from F. mungus shows discontinuous synthesis on both strands of the replication fork.
(c) Some of the DNA sequences from F. mungus are present in multiple copies per genome, whereas other sequences are unique.
(d) Short fragments of F. mungus DNA isolated during replication contain both ribose and deoxyribose.
(e) F. mungus cells are grown in the presence of the heavy isotopes 15N and 13C for several generations and then grown for one generation in normal (14N, 12C) medium; then DNA is isolated from these cells and denatured. The single strands yield a single band in a cesium chloride density gradient.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5
determine what amino acid will be formed from the given DNA strand below:
3’ T A C A T G C C G A A T G C C 5’
Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
1. Partner DNA strand
2. the mRNA strand
3. The tRNA
4. the formed amino acids
5. the discussion of the entire procedure
please help me with this question.
As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.
True or False. Explain.
A) At no time during protein synthesis does an amino acid make direct
contact with the mRNA being translated.
B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.
Chapter 17 Solutions
Becker's World of the Cell (9th Edition)
Ch. 17 - The theoretical amplification accomplished by n...Ch. 17 - Bacterial replication and that in typical...Ch. 17 - Nonhomologous end-joining and synthesis-dependent...Ch. 17 - Prob. 17.3CCCh. 17 - Meselson and Stahl Revisited. For each of the...Ch. 17 - DNA Replication. Sketch a replication fork of...Ch. 17 - More DNA Replication. The following are...Ch. 17 - QUANTITATIVE Still More DNA Replication. Suppose...Ch. 17 - The Minimal Chromosome. To enable it to be...Ch. 17 - Prob. 17.6PS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Question. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?arrow_forwardTrue or False. Topoisomerase I does not require ATP to break and rejoin DNA strands because the energy of the phospho-diester bond is stored transiently in a phospho-tyrosine linkage in the enzyme’s active site. Explain your answer in 2-3 sentences.arrow_forwardBackward? Bacteriophage T7 helicase moves along DNA in the 5'-to- 3'5'-to-3' direction. Other helicases have been reported to move in the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why you would expect helicases to move in one direction or the other?arrow_forward
- Draw a replication bubble. Be sure to label the directionality of all strands of DNA. For one of the two replication forks, draw and label all of the proteins required the text describes as being important for DNA synthesis, and label the leading and lagging strands.arrow_forwardTrue or False. Do single-stranded DNA strands stabilize other strands?arrow_forwardTrue or False. Each time the genome is replicated, half the newly synthesized DNA is stitched together from Okazaki fragments. Explain your answer in 1-2 sentences.arrow_forward
- Comprehensine. mfometion regordng boctenal replication Should be provided..arrow_forwardgene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forwardRNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forward
- True or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…arrow_forwardtransformation and CRISPR. In your own words, briefly describe two differences between these technologies. (For example, these can be differences between their outcomes, procedures, reagents, or something else.)arrow_forwardTRUE OR FALSE. Non-homologous end-joining as a DNA repair mechanism does not result in loss of nucleotides as a result of a double-strand break.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license