Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 17.2PS
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5
determine what amino acid will be formed from the given DNA strand below:
3’ T A C A T G C C G A A T G C C 5’
Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
1. Partner DNA strand
2. the mRNA strand
3. The tRNA
4. the formed amino acids
5. the discussion of the entire procedure
Draw a replication bubble. Be sure to label the directionality of all strands of DNA. For one of the two replication forks, draw and label all of the proteins required the text describes as being important for DNA synthesis, and label the leading and lagging strands.
elearn.squ.edu.om/mod/qu
NG SYSTEM (ACADEMIC)
Time left 0:44:39
If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between
the antiparallel strands?
O a.
GCGCGCGCGCGCGCGCGCGCG
O b. GGGGGCCCCCAATTCCCCCCC
O c. AAAAAATTTTTCCCCCGGGGG
O d. TACTACACTGTGGTTAATTAAA
O e. ATATATATCGCGTTAAATTCTA
CLEAR MY CHOICE
Match the given words with the most suitable words from the given list.
Unicellular fungi
Hyphae
Choose..
Chapter 17 Solutions
Becker's World of the Cell (9th Edition)
Ch. 17 - The theoretical amplification accomplished by n...Ch. 17 - Bacterial replication and that in typical...Ch. 17 - Nonhomologous end-joining and synthesis-dependent...Ch. 17 - Prob. 17.3CCCh. 17 - Meselson and Stahl Revisited. For each of the...Ch. 17 - DNA Replication. Sketch a replication fork of...Ch. 17 - More DNA Replication. The following are...Ch. 17 - QUANTITATIVE Still More DNA Replication. Suppose...Ch. 17 - The Minimal Chromosome. To enable it to be...Ch. 17 - Prob. 17.6PS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Pstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forwardTrue or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…arrow_forwardTrue or False. Topoisomerase I does not require ATP to break and rejoin DNA strands because the energy of the phospho-diester bond is stored transiently in a phospho-tyrosine linkage in the enzyme’s active site. Explain your answer in 2-3 sentences.arrow_forward
- TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The 2 subunits of DNA PoI II are called clamp loader and sliding clamps. 2. In eukaryotes, replication and transcription occur in the nucleus, while translation occurs in the cytoplasm.arrow_forwardTrue or False. Do single-stranded DNA strands stabilize other strands?arrow_forwardplease help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.arrow_forward
- Question. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?arrow_forwardNeed answer ASAP. The double-stranded molecule of DNA: AG/TC is a very good representation of the much larger chromosome. Diagram and label this molecule, then describe how would this molecule look if it were a DNA/RNA hybrid using the AG for the DNA strand.arrow_forwardTrue or False. In a comparison between the DNAs of related organisms such as humans and mice, conserved sequences represent functionally important exons and regulatory regions, and non-conserved sequences generally represent noncoding DNA. Explain your answer in 2-3 sentences.arrow_forward
- Pick a plasmid . What was its approximate transformation? Express it in # colonies per microgram of DNA transformed. Assume the original DNA was about .001 ug/ul . Count how many colonies you got on one plate (or estimate that number) and figure out how much of the total solution you plated on that plate. Multiply by all the plates, if you plated all of it. OR, if you only plated some of it, figure out how many colonies you would have gotten had you plated all of it. Divide by the number of ug used.arrow_forwardTRUE OR FALSE. Non-homologous end-joining as a DNA repair mechanism does not result in loss of nucleotides as a result of a double-strand break.arrow_forwardPlease help me with this please. I really don't know how to make this. I really do appreciate you're help. 1. make a simple illustration to relate the different kinds of DNA to its function.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license