Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15.1, Problem 2C
Different forms of a protein are produced in the liver and in the brain by alternate splicing of its mRNA. How would a researcher clone the gene encoding that protein to study the form that was produced in the liver?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
You want to clone a eukaryotic gene and express the corresponding protein in yeast. However, the protein typically localizes within mitochondria. How will you perform your gene cloning so that the protein is secreted from the cell, rather than localized within yeast mitochondria?
Which of the following methods is utilized by eukaryotes to control their gene expression that is different from the type of control found in bacteria?
a) control of chromatic remodeling.
b) control of RNA splicing.
c) transcriptional control.
d) control of both RNA splicing and chromatin remodeling.
How to incorporate prokaryotic gene into eukaryotic cell to make an transgenic organism?In this case what promoter will be used.explain the process in details
Chapter 15 Solutions
Biology (MindTap Course List)
Ch. 15.1 - Prob. 1LOCh. 15.1 - Explain how gel electrophoresis is used to...Ch. 15.1 - Describe how PCR is used to amplify a specific...Ch. 15.1 - Compare the possible differences between a...Ch. 15.1 - Prob. 1CCh. 15.1 - Different forms of a protein are produced in the...Ch. 15.1 - What advantages does the PCR method have over gene...Ch. 15.2 - Describe the features of a typical CRISPR locus in...Ch. 15.2 - Explain the function of CRISPR in bacterial cells.Ch. 15.2 - Compare CRISPR-based endonucleases with...
Ch. 15.2 - Prob. 8LOCh. 15.2 - Prob. 1CCh. 15.2 - Prob. 2CCh. 15.2 - Prob. 3CCh. 15.3 - Prob. 9LOCh. 15.3 - Prob. 10LOCh. 15.3 - Discuss how qPCR, DNA microarrays (DNA chips), and...Ch. 15.3 - Explain how you would compare the expression of a...Ch. 15.3 - Prob. 2CCh. 15.4 - Describe how genome-wide association studies have...Ch. 15.4 - Explain how targeted gene silencing and knockout...Ch. 15.4 - Prob. 1CCh. 15.5 - Describe at least one important application of DNA...Ch. 15.5 - Prob. 1CCh. 15.5 - What are short tandem repeats (STRs), and why are...Ch. 15.5 - Why do gene targeting and mutagenesis screening in...Ch. 15.6 - Prob. 15LOCh. 15.6 - Prob. 16LOCh. 15.6 - Prob. 1CCh. 15.6 - Prob. 2CCh. 15.7 - Describe at least two safety issue associated with...Ch. 15.7 - What are some of the environment concerns...Ch. 15 - A plasmid (a) can be used as a DNA vector (b) is a...Ch. 15 - DNA molecules with complementary sticky ends...Ch. 15 - Prob. 3TYUCh. 15 - Which technique rapidly replicated specific DNA...Ch. 15 - Prob. 5TYUCh. 15 - A cDNA clone contains (a) introns (b) exons (c)...Ch. 15 - Prob. 7TYUCh. 15 - Gel electrophoresis separates nucleic acids on the...Ch. 15 - A CRISPR locus in a bacterium contains (a) short...Ch. 15 - DNA molecular with complementary sticky ends...Ch. 15 - These highly polymorphic molecular markers are...Ch. 15 - Prob. 12TYUCh. 15 - Prob. 13TYUCh. 15 - Prob. 14TYUCh. 15 - EVOLUTION LINK DNA technology, such as the...Ch. 15 - SCIENCE, TECHNOLOGY, AND SOCIETY What are some...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe three possible uses of site-directed mutagenesis.arrow_forwardMutations in the CFTR gene result in cystic fibrosis in humans, a conditions in which abnormal secretions are present in the lungs, pancreas, and sweat glands. The gene was mapped to a 500-kb region on chromosome 7 containing 3 candidate genes. a)Using your knowledge of the disease symptoms, how would you distinguish between the candidate genes to decide which is most likely to encode the CFTR gene? b)How would you prove that your chosen candidate is the CFTR gene?arrow_forwardThere is a hypothetical gene related to the nervous system of Drosophila. Describe all the methods, steps, and key substances you need to obtain to use the following techniques in experimental design to study the gene: - In situ hybridization (to find the mRNA) - Immunohistochemistry (to find the protein) - CRISPR-Cas9 (for loss of function) - Expression vector (for gain of function)arrow_forward
- Consider a single base insertion mutation between the 3rd and 4th codons in a natural gene that encodes a protein 100 amino acids long. Is it more likely that the protein produced by this mutant allele will be shorter or longer than 100 amino acids long?arrow_forwardOne of the following best describes the cap modification of eukaryotic mRNAa) Modified guanine nucleotide added to the 3’ end of the transcriptb) Modified guanine nucleotide added to the 5’ end of the transcriptc) String of adenine nucleotides added to the 3’ end of the transcriptd) String of adenine nucleotides added to the 5’ end of the transcriptarrow_forwardYou have isolated a transposable element from the human genome and have determined its DNA sequence. How would you use this sequence to determine the copy number of the element in the human genome if you just had a computer with an Internet connection? (Hint: see Chapter 14.)arrow_forward
- Which of the following introns have self-splicing activity?a) Group I and group IIb) Group II and group IIIc) Group III and group IVd) Group I and group IIIarrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forwardAccording to the Central Dogma, genes are the blueprints for making proteins. Each gene (humans have 21,325) contains a single “coded message” of DNA bases (A, T, G, & C) attached in a specific order, which the cell “reads” to create an mRNA molecule that is then translated into protein. Knowing this, EXPLAIN how a SINGLE gene can make different proteins in different cells.arrow_forward
- Imagine that you and your colleagues are working in a lab to develop a protein synthesis system for a new type of synthetic cell. During your brainstorming sessions, you propose that polycistronic mRNA would be much more useful than mRNA that is only translated into one protein. This would allow for multiple proteins necessary for a particular function to be translated together. One of your colleagues says that is a good idea, but if you decide to go with polycistronic mRNA, you’d better make sure to use a prokaryotic translation system. Why might it be problematic to use a eukaryotic translation system with polycistronic mRNA? Mention three reasons:arrow_forwardYou obtained the sequence of the frog gene X you amplified in Question #16 through a process called automated sequencing. In automated sequencing, you are given a printout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space below. The reading frame DNA sequence is: 2.The mRNA sequence is: The polypeptide sequence is:arrow_forwardCodon optimization is a widely used process for recombinant expression in prokaryotic systems. Regarding this process, mark the incorrect alternative. * A)increases the overall yield of expression of recombinant proteins. B)prevents the formation of truncated proteins. C)increases the frequency of tRNAs that recognize rare codons. D)does not interfere with the primary sequence of the recombinant protein.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY