Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 15.1, Problem 1C
Summary Introduction
To write: The sequence and the position of the cut for the complementary strand of the DNA sequence 
.
Concept introduction: DNA is a double-stranded molecule consisting of two strands of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present.
In the tables below G^AATTC means that the end after cutting with enzyme will be:
-----G 3'
-----CTTAA 5'
GTGCA^C means that the end will be:
-----GTGCA 3'
-----C 5'
Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?
AccI
GT^CGAC
BamHI
G^GATCC
ClaI
AT^CGAT
NsiI
ATGCA^T
PstI
CTGCA^G
BglII
A^GATCT
TaqI
T^CGA
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
(i) Which of the DNA sequences shown below can be cut by using restriction enzyme?
Explain your answer by analysing the sequences.
Sequence A: 5'-AATGGCTGCCGTGGCTTA-3'
Sequence B: 5'-TAACCCTGCGCATTTGCA-3'
(ii) Given a DNA sequence, 5'-TACGAATTCGTAA-3' and EcoRI cutting site as below.
Write out the double stranded fragments that are generated when EcoRI works on this
DNA sequence.
EcoR I
5.. GAATTC...3'
3...CTTAAG...5'
Chapter 15 Solutions
Biology (MindTap Course List)
Ch. 15.1 - Prob. 1LOCh. 15.1 - Explain how gel electrophoresis is used to...Ch. 15.1 - Describe how PCR is used to amplify a specific...Ch. 15.1 - Compare the possible differences between a...Ch. 15.1 - Prob. 1CCh. 15.1 - Different forms of a protein are produced in the...Ch. 15.1 - What advantages does the PCR method have over gene...Ch. 15.2 - Describe the features of a typical CRISPR locus in...Ch. 15.2 - Explain the function of CRISPR in bacterial cells.Ch. 15.2 - Compare CRISPR-based endonucleases with...
Ch. 15.2 - Prob. 8LOCh. 15.2 - Prob. 1CCh. 15.2 - Prob. 2CCh. 15.2 - Prob. 3CCh. 15.3 - Prob. 9LOCh. 15.3 - Prob. 10LOCh. 15.3 - Discuss how qPCR, DNA microarrays (DNA chips), and...Ch. 15.3 - Explain how you would compare the expression of a...Ch. 15.3 - Prob. 2CCh. 15.4 - Describe how genome-wide association studies have...Ch. 15.4 - Explain how targeted gene silencing and knockout...Ch. 15.4 - Prob. 1CCh. 15.5 - Describe at least one important application of DNA...Ch. 15.5 - Prob. 1CCh. 15.5 - What are short tandem repeats (STRs), and why are...Ch. 15.5 - Why do gene targeting and mutagenesis screening in...Ch. 15.6 - Prob. 15LOCh. 15.6 - Prob. 16LOCh. 15.6 - Prob. 1CCh. 15.6 - Prob. 2CCh. 15.7 - Describe at least two safety issue associated with...Ch. 15.7 - What are some of the environment concerns...Ch. 15 - A plasmid (a) can be used as a DNA vector (b) is a...Ch. 15 - DNA molecules with complementary sticky ends...Ch. 15 - Prob. 3TYUCh. 15 - Which technique rapidly replicated specific DNA...Ch. 15 - Prob. 5TYUCh. 15 - A cDNA clone contains (a) introns (b) exons (c)...Ch. 15 - Prob. 7TYUCh. 15 - Gel electrophoresis separates nucleic acids on the...Ch. 15 - A CRISPR locus in a bacterium contains (a) short...Ch. 15 - DNA molecular with complementary sticky ends...Ch. 15 - These highly polymorphic molecular markers are...Ch. 15 - Prob. 12TYUCh. 15 - Prob. 13TYUCh. 15 - Prob. 14TYUCh. 15 - EVOLUTION LINK DNA technology, such as the...Ch. 15 - SCIENCE, TECHNOLOGY, AND SOCIETY What are some...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post herearrow_forwardGiven the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…arrow_forwardExamine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACarrow_forward
- Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?arrow_forwardThe following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?arrow_forwardRestriction endonuclease and ligase are two types of enzymes used in the process of genetic engineering, i.e., the manipulation of genes. The restriction endonuclease differs from ligase in that it breaks the DNA at ends, while ligase causes the breaks in DNA from interior joins the fragments of DNA, while ligase breaks the DNA into fragments breaks the DNA at specific points, while the ligase joins the fragments of DNA breaks the DNA apart at each nucleotide, while ligase use the pieces to translatearrow_forward
- Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.arrow_forwardWhich of the DNA sequences shown below can be cut by using restriction enzyme? Explain your answer by analysing the sequences. Sequence A: 5'-AATGGCTGCCGTGGCTTA-3' Sequence B: 5'-TAACCCTGCGCATTTGCA-3'arrow_forwardThe partial sequence of one strand of a double-stranded DNA molecule is 5'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG -3' EcoRI is a restriction enzyme that cleaves after G in the sequence 5'-GAATTC-3'. PstI is a restriction enzyme that cleaves after A in the sequence 5'-CTGCAG-3'. Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The first strand of your duplex DNA fragment should be derived from the given strand sequence. 5'- -3' 3'- -5'arrow_forward
- If a 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one you drew in part a? (Part a is attached)arrow_forwardthe one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?arrow_forwardSee the restriction enzyme map below. The total DNA length is 1800 base pairs. If this DNA is cut using three restriction enzymes, namely Kpnl, Sall and EcoRI, it yields four fragments with sizes of 390 bR. 810 bp, 270 bp www and 330 bp. Kpnl Sall EcoRI 390 810 270 330 1800 bp 1. If you were to subject this digested DNA to agarose gel electrophoresis, what would your gel look like? Draw a detailed picture of your gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. 2. You are provided with coiled DNA and plasmid DNA that you subject to gel electrophoresis. Draw this gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. Exac fragment sizes are not important.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License