Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15, Problem 3P
Reverse translation is a term given to the process of deducting the DNA sequence that could encode a particular protein. If you had the amino acid sequence Trp His Ile Met:
a. | What human nuclear DNA sequence could have encoded these amino acids? (Include all possible variations.) |
b. | What human mitochondrial DNA sequence could have encoded these amino acids? (Include all possible variations.) |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was substituted with C (Question C) ?
Question C:
Guanine nucleotide (G shown in red in the DNA sequence below) was substituted by C Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?)
Reverse translation is a term given to the process ofdeducing the DNA sequence that could encode a particular protein. If you had the amino acid sequenceTrp His Ile Met:a. What human nuclear DNA sequence could haveencoded these amino acids? (Include all possiblevariations.)b. What human mitochondrial DNA sequence couldhave encoded these amino acids? (Include allpossible variations.)
a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
Chapter 15 Solutions
Genetics: From Genes to Genomes
Ch. 15 - Match each numbered item with the most closely...Ch. 15 - Assuming human cells have on average 1000...Ch. 15 - Reverse translation is a term given to the process...Ch. 15 - The human nuclear genome encodes tRNAs with 32...Ch. 15 - The human mitochondrial genome includes no genes...Ch. 15 - How do you know if the halibut you purchased at...Ch. 15 - Is each of these statements true of chloroplast or...Ch. 15 - Suppose you are characterizing the DNA of a...Ch. 15 - An example of a gene-targeting DNA plasmid vector...Ch. 15 - Which of the following characteristics of...
Ch. 15 - The Saccharomyces cerevisiae nuclear gene ARG8...Ch. 15 - The so-called hypervariable regions HV1 and HV2 of...Ch. 15 - Suppose a new mutation arises in a mitochondrial...Ch. 15 - Describe at least two ways in which the...Ch. 15 - Why are severe mitochondrial or chloroplast gene...Ch. 15 - Suppose you are examining a newly found plant...Ch. 15 - A form of male sterility in corn is inherited...Ch. 15 - Plant breeders have long appreciated the...Ch. 15 - A mutant haploid strain of Saccharomyces...Ch. 15 - Prob. 20PCh. 15 - What characteristics in a human pedigree suggest a...Ch. 15 - The first person in the family represented by the...Ch. 15 - In 1988, neurologists in Australia reported the...Ch. 15 - If you were a genetic counselor and had a patient...Ch. 15 - Kearns-Sayre syndrome KSS, Pearson syndrome, and...Ch. 15 - Many clinically relevant mitochondrial diseases...Ch. 15 - Leigh syndrome is characterized by psychomotor...Ch. 15 - All mutations in mitochondrial genes ultimately...Ch. 15 - How could researchers have determined that the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Sickle cell anemia is an example of a genetic disease caused by a point mutation. To answer this question look at the information in chapter 3 of the OpenStax book. If you use another resource that is fine but you will need to share the link. a. Describe the specific change in the nucleotide sequence sequence from normal to mutated hemoglobin. b. Describe the specific change in the amino acid sequence from normal to mutated hemoglobin. c. Explain the structural effect that this point mutation has on the hemoglobin protein. d. Explain how this mutation affects the function of the hemoglobin protein.arrow_forwardRefer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)arrow_forwardDNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. How many introns and exons are there in this gene? Explain your answer.arrow_forward
- Consider the following gene with their respective introns and exons 5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequencearrow_forwardIn the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútationarrow_forwardThe human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?arrow_forward
- Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids of a protein : The first three underlined base pairs indicate the frame and include the coding region . 123456789 A. Write the peptide sequence of the last 6 amino acids of the protein . Label both ends of the peptide . B. A insertion of one base pair causes the protein to decrease in length by 5 amino acids . With respect to the sequence given above , where does this insertion occur , and what base pair will you insert ? C. An change of one base pair leads to the protein to increase in length by one amino acid. With respect to the sequence given above , which base pair would you change ? How would you change this base pair for the protein to increase in length by one amino acid ?arrow_forwardBelow is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forward
- A diploid human cell contains approximately 6.4 billion base pairs of DNA. a. How many nucleosomes are present in such a cell? (Assume that the linker DNA encompasses 40 bp.) b. How many histone proteins are complexed with this DNA?arrow_forwardA 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600 amino acids and the other gene encodes a protein of 280 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences (i.e. they do not overlap). How is this possible? Fully explain your answer.arrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License