Prescott's Microbiology
11th Edition
ISBN: 9781260211887
Author: WILLEY, Sandman, Wood
Publisher: McGraw Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 2AL
You have isolated several E. coli mutants:
Mutant #1 has a point mutation (a single base-pair change) in the −10 region of the promoter of a gene encoding an enzyme needed for synthesis of the amino acid serine.
Mutant #2 has a mutation in the −35 region in the promoter of the same gene.
Mutant #3 is a double mutant with mutations in both the −10 and −35 region of the promoter of the same gene.
Only Mutant #3 is unable to make serine. Why do you think this is so?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A series of exonuclease deletions were used to study the promoter of the rice hemA gene, giving the results shown below (the intact promoter is on
top). Based on these results, what conclusions could you draw from each of the deletion construct, and what do you know about the nature of the
promoter?
Relative activity
-500
Reporter gene
100%
Reporter gene
180%
-350
-250-
Reporter gene
180%
75%
-150
Reporter gene
45%
Reporter gene
-100
0%
- 8
Reporter gene
You have isolated a mutant that you call Mutant Z. In a Mutant Z strain, the RNA polymerase can
bind to the promoter, but it does not stay bound (e.g. it can only bind reversibly). A mutation in
which of the following cis elements could lead to the Mutant Z phenotype? (you may select more
than one option)
Oribosome binding site
O-35 promoter region
Odomain 2 of sigma
3/4 linker of sigma
-10 promoter region
Odomain 1 of sigma
Olac repressor
Odomain 4 of sigma
You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience.
From this experiment you can conclude that:
Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon).
True or false:
Spacer
(a)
-10 region
-35 region
TTGACA
Consensus sequence
TATAAT
Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT
Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT
Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT
Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT
Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT
(b)
700
600-
500-
400-
300-
200-
100.
0
● True
O False
B-Galactosidase activity
Wild-type…
Chapter 13 Solutions
Prescott's Microbiology
Ch. 13.1 - MICRO INQUIRY Based on what we now know about...Ch. 13.1 - Prob. 2MICh. 13.1 - Retrieve, Infer, Apply 1. Briefly summarize the...Ch. 13.1 - Retrieve, Infer, Apply 2. Explain how protein was...Ch. 13.2 - MICRO INQUIRY To which carbon of ribose...Ch. 13.2 - MICRO INQUIRY How many H bonds are there between...Ch. 13.2 - Prob. 3MICh. 13.2 - Prob. 1CCCh. 13.2 - Retrieve, Infer, Apply What does it mean to say...Ch. 13.2 - Retrieve, Infer, Apply Amino acids are described...
Ch. 13.3 - MICRO INQUIRY What provides the energy to fuel...Ch. 13.3 - MICRO INQUIRY What is the difference between...Ch. 13.3 - MICRO INQUIRY Why cant DNA polymerase I perform...Ch. 13.3 - Retrieve, Infer, Apply How many replicons do...Ch. 13.3 - Prob. 2CCCh. 13.3 - Retrieve, Infer, Apply Describe the nature and...Ch. 13.3 - Retrieve, Infer, Apply Outline the steps Involved...Ch. 13.3 - Retrieve, Infer, Apply What is the end replication...Ch. 13.4 - Why is the nontemplate strand called the sense...Ch. 13.4 - Retrieve, Infer, Apply The coding region of a gene...Ch. 13.4 - Which strand of a gene has sequences that...Ch. 13.4 - Briefly discuss the general organization of tRNA...Ch. 13.5 - MICRO INQUIRY Are the -35 and -10 regions...Ch. 13.5 - Retrieve, Infer, Apply Outline the transcription...Ch. 13.5 - Retrieve, Infer, Apply What is a polycistronic...Ch. 13.5 - Retrieve, Infer, Apply What is a consensus...Ch. 13.5 - Tabulate the similarities and differences between...Ch. 13.6 - Prob. 1MICh. 13.6 - What is the difference between a codon and an...Ch. 13.6 - Prob. 2CCCh. 13.6 - Retrieve, Infer, Apply What is meant by code...Ch. 13.6 - Retrieve, Infer, Apply Is the genetic code truly...Ch. 13.7 - MICRO INQUIRY Why is simultaneous transcription...Ch. 13.7 - MICRO INQUIRY What would be the outcome if an...Ch. 13.7 - MICRO INQUIRY Why would it be impossible for...Ch. 13.7 - MICRO INQUIRY What provides the energy to fuel...Ch. 13.7 - Retrieve, Infer, Apply In which direction are...Ch. 13.7 - Retrieve, Infer, Apply Briefly describe the...Ch. 13.7 - Retrieve, Infer, Apply What are the translational...Ch. 13.7 - Prob. 4CCCh. 13.7 - Retrieve, Infer, Apply How many ATP and GTP...Ch. 13.8 - Prob. 1CCCh. 13.8 - Prob. 2CCCh. 13.8 - Retrieve, Infer, Apply Give the major...Ch. 13.8 - Prob. 4CCCh. 13 - Prob. 1RCCh. 13 - Prob. 2RCCh. 13 - Prob. 3RCCh. 13 - Prob. 4RCCh. 13 - Prob. 5RCCh. 13 - Streptomyces coelicolor has a linear chromosome....Ch. 13 - You have isolated several E. coli mutants: Mutant...Ch. 13 - Prob. 3ALCh. 13 - Prob. 4AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- When a region of DNA that contains the genetic information for a protein is isolated from a bacterial cell and inserted into a eukaryotic cell in a proper position between a promoter and a terminator, the resulting cell usually produces the correct protein. But when the experiment is done in the reverse direction (eukaryotic DNA into a bacterial cell), the correct protein is often not produced. Can you suggest an explanation?arrow_forwardThe sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The activity of these promoters is measured by fusing the them to the gene for Green Fluorescent Protein (GFP) and measuring the production of green fluorescence by GFP protein. What would you expect the GFP signal to be higher, lower or same for mutant promoters. Mutn 1 (enter higher, lower or same) Mutn 2 (enter higher, lower or same) - 42 ? ? +1 Lac CCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA CCAGGCTTAAAACTTTATGCTTCCGGCTCGTATGTTGTGTGGA Lac Mutl Lac Mut 2 CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAarrow_forwardYou are studying a human gene, and try to express the protein in E. coli bacterial cells. To do this, you use lab cloning techniques to create an expression vector - a circular piece of DNA (plasmid) which can replicate within E. coli, and which contains an appropriate E. coli promoter sequence before the human protein sequence. Note that the sequence used is the final mRNA protein coding sequence, with all introns removed. You can detect that some of the protein is produced, but it's a very small amount. Luckily you included a positive control, which uses the same expression vector, and find that the control E. coli protein is expressed to high levels under the same conditions. A colleague suggests that you transform your same expression vector into a 'humanized' strain of E. coli that is optimized for the expression of human recombinant proteins (this is a real thing!). You do this and see protein expression – woohoo! If the genetic code is universal, why might a human gene be poorly…arrow_forward
- Tryptophan synthase is one of the enzymes synthesized from the trp mRNA. In wild-type E. coli, the trp mRNA has a short half-life, but the tryptophan synthase half-life is much longer. To investigate how changes to the stability of the enzyme or its mRNA affect enzyme activity, two strains of E. coli were engineered. Strain A stabilizes the trp mRNA and strain B rapidly degrades tryptophan synthase. The wild-type, A, and B strains were grown in a medium with glucose as the sole carbon source. After several generations, tryptophan was added to all three cultures and tryptophan synthase activity was measured periodically. Note: Evaluate each condition as a simple model, where changes in the stability of trp mRNA or tryptophan synthase do not elicit secondary effects in the cells. Select the statements that describe the expected change in tryptophan synthase activity after the addition of tryptophan. In strain B, since both the trp mRNA and tryptophan synthase are rapidly degraded, the…arrow_forwardYou have generated 5 different cancer cell lines in your laboratory. In cancer cell line A there is a deletion of gene A In cancer cell line B, the promoter for gene B is over-methylated In cancer cell line C, there is a nonsense mutation near the start codon of gene C In cancer cell line D, there is a duplication of gene D In cancer cell line E, a translocation puts gene E close to an active promoter Each of the genes above is implicated in cancer. What is most likely, given the information? Gene A is likely to be a: Proto-oncogene/ Tumor Suppressor/ Neither Gene B is likely to be a: Proto-oncogene/ Tumor Suppressor/ Neither Gene C is likely to be a: Proto-oncogene/ Tumor Suppressor/ Neither Gene D is likely to be a: Proto-oncogene/ Tumor Suppressor/ Neither Gene E is likely to be a: Proto-oncogene/ Tumor Suppressor/ Neitherarrow_forwardSelect all the possible mutation types for the following observed phenotype resulting from a mutation in a coding gene: A protein is made in normal amount, has a regular shape, but is expressed in the wrong cells. a up promoter mutation a non conservative missense mutation an in-frame insertion of 2 amino acids a down promoter mutationarrow_forward
- You have isolated different mutants (reg1 and reg2) causing constitutive expression of the emu operon (which has genes emu1 and emu2). One mutant contains a defect in a DNA-binding site, and the other has a loss-of-function defect in the gene encoding a protein that binds to the site Say you don’t know which mutant has a defect in the site and which one has a mutation in the binding protein. To figure it out, you construct the two partial diploid strains (i and ii below), and you then assay the levels of the Emu1 and Emu2 proteins in these two strains. F’ (reg1- reg2+ emu1- emu2+) / reg1+ reg2+ emu1+ emu2- F’ (reg1+ reg2- emu1- emu2+) / reg1+ reg2+ emu1+ emu2- What proteins do you predict will be expressed for strains i and ii if reg2 encodes the regulatory protein and reg1 is the regulatory site?arrow_forwardThe following diagram show what is required for an active promoter of a gene of interest, where:A1 = Activator 1A2 = Activator 2Med = MediatorRep = Repressor Based on the following data, predict: Chromatin conformation Methylation state of the proximal promoter If protein A1 is present or absent If protein A2 is present or absent If the mediator is present or absent If the repressor is absence or present If this gene is likely to be transcribed or notPlease note that this is an "all or nothing" bonus question, and no partial credit will be awarded. Selecting all answers will result in zero points awarded. Selecting at least one incorrect answer will result in zero points being awarded. Question 28 options: Euchromatin Heterochromatin Methylated promoter Unmethylated promoter Activator A1 present Activator A1 absent Activator A2 present…arrow_forwardResearchers have identified a gene (FR) responsible for watermelon resistance to infection by Dacus curcurbitae (a close relative of Drosophila melanogaster). They isolate RNA from resistant (FR+) and sensitive (fr-) watermelons and use a probe that will recognize both FR+ and fr- transcripts. They also isolate protein from resistant and sensitive watermelons and perform a Western blot using an antibody that can recognize the fr- and FR+ protein. Describe the results illustrated below and give a plausible molecular explanation for these observations.arrow_forward
- When an EcoR1 fragment, which represents the coding region of a human gene X, is cloned into the EcoR1 site upstream of the coding region of a prokaryotic gene (such as GST) (i.e., to make a X-GST fusion protein), what is the chance of an in-frame fusion? Please draw a diagram to explain your answer. Do you need to delete the stop codon of the X gene coding region before fusing it to the GST coding region? Please draw a diagram to explain your answer. Notes: It is NOT known which strand of the human gene X is the template strand for transcription. 2) Both X and GST protein fragments must be produced correctly)arrow_forwardWild-type E. coli grow best at 37oC, but can grow efficiently at temperatures up to 42oC. An E. coli strain has a mutation in the gene encoding rho protein that results in a stable protein at 37oC, but this mutant protein ceases to function at 42oC. When bacteria bearing this temperature-sensitive mutation are raised at 42oC, which of the following effects would you expect to see? Explain your reasoning for each of the 5 optionsa. Transcription does not take placeb. All RNA molecules are shorter than normalc. All RNA molecules are longer than normald. Some RNA molecules are longer than normal e. RNA is transcribed from both strandsarrow_forwardYou then make a screen to identify potential mutants (shown as * in the diagram) that are able to constitutively activate Up Late operon in the absence of Red Bull and those that are not able to facilitate E. Coli growth even when fed Red Bull. You find that each class of mutations localize separately to two separate regions. For those mutations that prevent growth even when fed Red Bull are all clustered upstream of the core promoter around -50 bp. For those mutations that are able to constitutively activate the operon in the absence of Red Bull are all located between the coding region of sleep and wings. Further analysis of each DNA sequence shows that the sequence upstream of the promoter binds the protein wings and the region between the coding sequence of sleep and wings binds the protein sleep. When the DNA sequence of each is mutated, the ability to bind DNA is lost. Propose a final method of gene regulation of the Up Lateoperon using an updated drawn figure of the Up Late…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY