Propose a final method of gene regulation of the Up Lateoperon using an updated drawn figure of the Up Late operon.

Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
icon
Related questions
icon
Concept explainers
Question

You then make a screen to identify potential mutants (shown as * in the diagram) that are able to constitutively activate Up Late operon in the absence of Red Bull and those that are not able to facilitate E. Coli growth even when fed Red Bull. You find that each class of mutations localize separately to two separate regions. For those mutations that
prevent growth even when fed Red Bull are all clustered upstream of the core promoter around -50 bp. For those mutations that are able to constitutively activate the operon in the absence of Red Bull are all located between the coding region of sleep and wings. Further analysis of each DNA sequence shows that the sequence upstream of the promoter binds the protein wings and the region between the coding sequence of sleep
and wings binds the protein sleep. When the DNA sequence of each is mutated, the ability to bind DNA is lost. Propose a final method of gene regulation of the Up Lateoperon using an updated drawn figure of the Up Late operon. Explain in detail.

You are studying a new operon that you have discovered in E. Coli that you have named the Up
Late operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You have
discovered three genes (sleep, wings, and energy) encoded within the polycistronic template
made from the operon. The transcription start site is indicated at the arrow and the protein
encoding sequences are encoded by the boxes with the names of the genes inside, with a blow
up of the nucleotide sequence at the promoter, with the transcription start occurring at the C.
(Asterisks for part F)
sleep
wings
energy
5'-TGTTGAСАСАТСАGGCТAGCATTАTААAGCCGGCTAGCTAGCATGCAAAGCCTАCGTT-3'
3'-АСААСТGTGTAGTCCGATCGTAATATTТCGGCCGAТCGATCGTACGTTTCGGATGCAA-5'
Transcribed Image Text:You are studying a new operon that you have discovered in E. Coli that you have named the Up Late operon for its ability to help E. Coli grow and divide by feeding it Red Bull. You have discovered three genes (sleep, wings, and energy) encoded within the polycistronic template made from the operon. The transcription start site is indicated at the arrow and the protein encoding sequences are encoded by the boxes with the names of the genes inside, with a blow up of the nucleotide sequence at the promoter, with the transcription start occurring at the C. (Asterisks for part F) sleep wings energy 5'-TGTTGAСАСАТСАGGCТAGCATTАTААAGCCGGCTAGCTAGCATGCAAAGCCTАCGTT-3' 3'-АСААСТGTGTAGTCCGATCGTAATATTТCGGCCGAТCGATCGTACGTTTCGGATGCAA-5'
F. You then make a screen to identify potential mutants (shown as in the diagram) that
are abie to consitulively activate Up Late operan in the absence of Red Bui and those
that are not able to facilitate E. Coli growth even when fed Red Bull. You find that each
dass of mutations localize separately to two separate regions. For those mutations that
prevent growth even when fed Red Bul are all dustered upstream of the core promoter
around -50 bp. For those mutations that are able to constitutively activate the operon in
the absence of Red Bull are all located between the coding region of sieep and wings.
Further analysis of each DNA sequence shows that the sequence upstream of the
promoter binds the protein wings and the region between the coding sequence of sieep
and wings binds the protein sloep. When the DNA soquence of each is mutated, the
ability to bind DNA is lost. Propose a final method of gene regulation of the Up Late
operon using an updated drawn figure of the Up Late operon.
Transcribed Image Text:F. You then make a screen to identify potential mutants (shown as in the diagram) that are abie to consitulively activate Up Late operan in the absence of Red Bui and those that are not able to facilitate E. Coli growth even when fed Red Bull. You find that each dass of mutations localize separately to two separate regions. For those mutations that prevent growth even when fed Red Bul are all dustered upstream of the core promoter around -50 bp. For those mutations that are able to constitutively activate the operon in the absence of Red Bull are all located between the coding region of sieep and wings. Further analysis of each DNA sequence shows that the sequence upstream of the promoter binds the protein wings and the region between the coding sequence of sieep and wings binds the protein sloep. When the DNA soquence of each is mutated, the ability to bind DNA is lost. Propose a final method of gene regulation of the Up Late operon using an updated drawn figure of the Up Late operon.
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 3 steps

Blurred answer
Knowledge Booster
Bacterial genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education