Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 5TYU
If a segment of DNA is 5′ — CATTAC — 3′, the complementary DNA strand is (a) 3′ — CATTAC — 5′ (b) 3′ — GTAATG — 5′ (c) 5′ — CATTAC — 3′ (d) 5′ — GTAATG — 3′ (e) 5′ — CATTAC —5′
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’
a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence?
b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence?
c) What would be the other strand of DNA?
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’
Write:
a) the sequence of the complementary DNA strand
Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA
Chapter 12 Solutions
Biology (MindTap Course List)
Ch. 12.1 - Summarize the evidence that accumulated during the...Ch. 12.1 - Prob. 2LOCh. 12.1 - Prob. 1CCh. 12.1 - Prob. 2CCh. 12.2 - Explain how nucleotide subunits link to form a...Ch. 12.2 - Describe how the two strands of DNA are oriented...Ch. 12.2 - Prob. 5LOCh. 12.2 - Prob. 1CCh. 12.2 - Prob. 2CCh. 12.2 - Prob. 3C
Ch. 12.3 - Cite evidence from Meselson and Stahls experiment...Ch. 12.3 - Prob. 7LOCh. 12.3 - Explain the complexities of DNA replication that...Ch. 12.3 - Discuss how enzymes proofread and repair errors in...Ch. 12.3 - Prob. 10LOCh. 12.3 - How did the ability to distinguish old and newly...Ch. 12.3 - What feature of DNA structure causes DNA...Ch. 12.3 - What is the reason that eukaryotic cells require...Ch. 12 - When Griffith injected mice with a combination of...Ch. 12 - Which of the following inspired Avery and his...Ch. 12 - In the Hershey-Chase experiment with...Ch. 12 - The two complementary strands of the DNA double...Ch. 12 - If a segment of DNA is 5 CATTAC 3, the...Ch. 12 - Each DNA strand has a backbone that consists of...Ch. 12 - The experiments in which Meselson and Stahl grew...Ch. 12 - The statement DNA replicates by a semiconservative...Ch. 12 - Topoisomerases (a) synthesize DNA (b) synthesize...Ch. 12 - A lagging strand forms by (a) joining primers (b)...Ch. 12 - The immediate source of energy for DNA replication...Ch. 12 - Which of the following statements about eukaryotic...Ch. 12 - Prob. 13TYUCh. 12 - Prob. 14TYUCh. 12 - Prob. 15TYUCh. 12 - INTERPRET DATA In the Hershey-Chase experiment,...Ch. 12 - EVOLUTION LINK How does DNA being the universal...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the diagram of DNA at the right: a) fill in the letters representing the bases on the right-hand strand. b) How many nucleotides are shown? 6 c) Explain why these two strands are described as "anti-parallel." because two stands in apposite directions d) If the DNA strand on the left is the coding strand, what mRNA sequence would be transcribed from it? ACG e) What amino acid would that mRNA strand code for? (read the letters from top to bottom) (The) threonine 2' 1' 2 AT बबब GH Carrow_forwardWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATarrow_forwardIf a strand of DNA has the sequence CGGTATATC, then the complementary strand of DNA has the sequence (a) ATTCGCGCA. (b) GCCCGCGCT. (c) GCCATATAG. (d) TAACGCGCT.arrow_forward
- The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a solution containing the three DNA molecules below, in what order do you think these DNAs will "melt"? Explain 1)5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ 2) 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’ 3) 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’arrow_forwardWhich of the following is NOT a characteristic of the DNA Double Helix? a) The two strands run in an anti-parallel fashion based on their polarity. b) Hydrogen bonding between nucleotides holds the strands together. c) DNA is 20 Angstrom's wide. d) The percentage of Guanine and Thymine present in a double helix strand are always equal.arrow_forwardA) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the complementary base sequence for the matching strand in the DNA section shown below.5’ – C T G T A T A C G T T A – 3’ Please answer both partsarrow_forward
- Which of the following single stranded DNA oligonucleotides alone would be expected to spontaneously form linear double stranded DNA molecules? A) 5'-ACGTTGCA-3' B) 5'-GGGGGGGC-3' C) 3'-GTCCCTAT-5 D) 3-CTAATTAG-5' asap pleasearrow_forwardGiven the following sequence for one strand of a double-stranded oligonucleotide: 5'ACCGTAAGGCTTTAG3' (a) Write the sequence for the complementary DNA strand. (b) Suppose you knew that the strand shown above had phosphate on both ends. Using an accepted nomenclature, write the sequence so as to show this. (c) Write the sequence of the RNA complementary to the strand shown above.arrow_forward(a) Write the DNA double strand. (b) Assuming the gel pattern represents the template strand, transcribe and translate the DNA. (c) Write the anticodon sequence. A G 2nd (middle) Base of a Codon 1* 3rd U A G Base Base UUU - Phe U UUC - Phe UCU - Ser UCC - Ser UAU - Tyr UAC - Tyr UGU - Cys UGC - Cys UUA - Leu UCA- Ser UAA - STOP UGA - STOP UUG -Leu CUU - Leu CUC - Leu UCG-Ser CCU - Pro CCC- Pro UAG- STOP CAU - His САC - His UGG- Trp CGU - Arg CGC - Arg CGA - Arg CGG- Arg CỦA - Leu ССА-Pro CAA - Gin CAG- Gin AAU - Asn CUG - Leu CCG-Pro AUU - Ile ACU - Thr АCC - Th ACA - Thr AGU – Ser A AGC - Ser AGA - Arg AGG - Arg GGU - Gly GGC - Gly GGA - Gly GGG - Gly AUC - lle AAC - Asn AAA - Lys AAG - Lys GAU - Asp GAC - Asp GAA - Glu AUA- lle AUG - Met ACG - Thr G GUU - Val GCU - Ala GCC - Ala GUC - Val GUA- Val GCA - Ala GUG - Val GCG - Ala GAG - Glu PUAGPCAGUCACUCAG |arrow_forward
- Plx asaparrow_forward(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?arrow_forwardYou have created a synthetic nucleotide, nucleotide X, which can be substituted into a DNA strand and is able to pair with C nucleotides. However, a C-X pairing is joined by a single hydrogen bond. If you were to create a DNA strand made with A, C, T and your new nucleotide X instead of G the new strand would... a) Denature at higher temperatures than a strand made with A, C, G, and T b) Expect helicase would have more difficulty separating these strands than strands made with A, C, G and T c) Denature at lower temperatures than a strand made with A, C, G, and T d) Not expect to see any differences in the physical properties of this DNA compared to DNA made with A, C, G and Tarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY