Microbiology: An Evolving Science (Fourth Edition)
4th Edition
ISBN: 9780393615098
Author: John W. Foster, Joan L. Slonczewski
Publisher: W. W. Norton & Company
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 2RQ
Summary Introduction
To review:
The methods that can be used to determine the possible function of a gene product in case the DNA sequence of a gene is known.
Introduction:
Genome annotation is also known as DNA (deoxyribonucleic acid) annotation. It is a method used to identify the location and the function of the gene product-protein. Annotation, in general, is an explanation of the entity. Gene prediction is an important part of the process of genome annotation. There are two types of genome annotation, structural and functional annotation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which statement would be the best answer for the gene sequence?
Describe how to determine the quality of DNA sequences using a chromatogram .
What is The Most Direct Method to Find Genes ?
Chapter 12 Solutions
Microbiology: An Evolving Science (Fourth Edition)
Ch. 12.1 - Prob. 1TQCh. 12.1 - Prob. 2TQCh. 12.1 - Prob. 3TQCh. 12.1 - Prob. 4TQCh. 12.2 - Prob. 1TQCh. 12.2 - Prob. 2TQCh. 12.2 - Prob. 3TQCh. 12.3 - Prob. 1TQCh. 12.4 - Prob. 1TQCh. 12.4 - Prob. 2TQ
Ch. 12.5 - Prob. 1TQCh. 12 - Prob. 1RQCh. 12 - Prob. 2RQCh. 12 - Prob. 3RQCh. 12 - Prob. 4RQCh. 12 - Prob. 5RQCh. 12 - Prob. 6RQCh. 12 - Prob. 7RQCh. 12 - Prob. 8RQCh. 12 - Prob. 9RQCh. 12 - Prob. 10RQCh. 12 - Prob. 11RQCh. 12 - Prob. 12RQCh. 12 - Prob. 13RQCh. 12 - Prob. 14RQCh. 12 - Prob. 15RQCh. 12 - Prob. 1TQCh. 12 - Prob. 2TQCh. 12 - Prob. 3TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Who has access to the human DNA sequence?arrow_forwardHow is the information in the DNA interpreted into a functional protein,such as an enzyme?arrow_forwardThe illumina method of sequencing uses a unique type of nucleotide building block. What is the specific characteristic of this type of nucleotide that is important for this method of sequencing? How is the sequence of a fragment of DNA determined using this method? (USE THIS LINK AND WRITE ANSWERS IN YOUR LANGUAGE PLEASE DON'T COPY SAME AS GIVEN IN SITE https://www.mybiosource.com/learn/testing-procedures/dna-sequencing/arrow_forward
- Identical twin brothers begin life with identical genomes andepigenomes. How will this circumstance change with age?Suggest how these changes could be used as a forensic tool.arrow_forwardA geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: — AATTGCCCGATCGATTAAGCCA — Sequence with treatment: — AATTGTTTGATCGATTAAGCTA —arrow_forwardWhich of the following pairs of sequences would be considered different alleles in DNA profiling? a) ATGAATTCGG; ATGAAATCGG b) ATGAATTCGG; TACTTACTTACT c) GAAGAAGAA; GAAGAAGAAGAA d) AATAATAATAAT; AATTAATTAATTarrow_forward
- What is DNA fingerprinting? What types of sequences are examined in DNA fingerprinting?arrow_forwardAn effective DNA probe can sometimes be developed by knowing the amino acid sequence of the protein encoded by the gene. A student argued that this is too time-consuming since the complete amino acid sequence must be determined in order to create the probe. Does the student have a valid argument? Why or why not?arrow_forwardA mixture of amino acids that do not separate sufficiently when a single technique is used can often be separated by two-dimensional chromatography. In this technique, the mixture of amino acids is applied to a piece of filter paper and separated by chromatographic techniques. The paper is then rotated 90°, and the amino acids are further separated by electrophoresis, producing a type of chromatogram called a fingerprint. Identify the spots in the fingerprint obtained from a mixture of Ser, Glu, Leu, His, Met, and Thr.arrow_forward
- What Is a DNA Library?arrow_forwardAilee is interested to determine the nucleotide sequence of her bacterial heat shock gene. Hence, DNA sequencing needs to be performed for this analysis. One of the earliest methods invented is known as Sanger sequencing. Explain in detail the mechanism of this sequencing technique with the aid of a simple diagram.arrow_forwardWhat is meant by the term DNA sequence?arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License