Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Question

Want to see the full answer?

Answer 1

Question

Chapter 11, Problem 8MCQ

Summary Introduction

Introduction:

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…

A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of the mutant DNA strand? The sequence of the mutant strand is shown below: 5'-TGCCATAACTGTTCGTACTGGCAAATTGCC-3' 3'-ACGGTATTGACAAGCATGACCGTTTAACGG-5' b. The mutation altered the sequence of the wild type template DNA such that a degenerate codon for a basic amino acid in the wild type was converted to a non-degenerate codon resulting in the sequence for the mutant strand shown. What was the original amino acid? c. Compare the charges and pl of the mutant peptide and the normal (wild- type) peptide at physiological pH?

1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution

Answer 2

Question

Chapter 11, Problem 8MCQ

Summary Introduction

Introduction:

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 11, Problem 8MCQ

Summary Introduction

Introduction:

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 11, Problem 8MCQ

Summary Introduction

Introduction:

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 11, Problem 8MCQ

Summary Introduction

Introduction:

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Answer 6

Chapter 11, Problem 8MCQ

Summary Introduction

Introduction:

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Answer 7

Chapter 11, Problem 8MCQ

Summary Introduction

Introduction:

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 11.1 - What is DNA technology?Ch. 11.1 - In what fields is DNA technology useful?Ch. 11.2 - What are some uses for transgenic organisms?Ch. 11.2 - What are the steps in producing a transgenic...Ch. 11.2 - How do tagged nucleotides participate in first...Ch. 11.2 - What is the function of 98.5 of the human genome...Ch. 11.2 - How does PCR work, and why is it useful?Ch. 11.2 - How are short tandem repeats used in DNA...Ch. 11.2 - Why do investigators sometimes analyze...Ch. 11.3 - Describe the differences among embryonic, adult,...

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Solution Summary: The author explains that short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR.

Introduction:

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Want to see the full answer?

Chapter 11 Solutions

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Solution Summary: The author explains that short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR.

Introduction: Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.

Want to see the full answer?

Chapter 11 Solutions

Introduction:

Short oligonucleotide sequences are used to bind with DNA fragment of interest which elongate, and new copies of DNA are synthesized in PCR. These short oligonucleotide sequences are called primers.