Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 30PDQ
Because of its rapid turnaround time, fluorescent in situ hybridization (FISH) is commonly used in hospitals and laboratories as an aneuploid screen of cells retrieved from amniocentesis and chorionic villus sampling (CVS). Chromosomes 13, 18, 21, X, and Y (see Chapter 8) are typically screened for aneuploidy in this way. Explain how FISH might be accomplished using amniotic or CVS samples and why the above chromosomes have been chosen for screening.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…
Explain how DNA probes with different fluorescence emissionwavelengths can be used in a single FISH experiment to map thelocations of two or more genes. This method is called chromosomepainting. Explain why this is an appropriate term.
Diagram and explain how APEX probes can be used to determine that an individual is CC
(homozygous) for a specific G/C SNV. Recall that the genotype of an SNV is identified from the strand
shown in NCBI. What color fluorescence will be observed? Also, explain why a left apex probe cannot be
used for this SNV. The SNV sequence, on the strand shown in NCBI, and a few nucleotides adjacent to
the SNV are below:
5'-------TGT(G/C)CAG------3'
Chapter 10 Solutions
Concepts of Genetics (12th Edition)
Ch. 10 - Would an experiment similar to that performed by...Ch. 10 - In sea urchin DNA, which is double stranded, 17.5...Ch. 10 - German measles results from an infection of the...Ch. 10 - What vital clues were provided by Franklins work...Ch. 10 - Was it ethical for Wilkins to show Franklins...Ch. 10 - Prob. 3CSCh. 10 - HOW DO WE KNOW? In this chapter, we first focused...Ch. 10 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 10 - Discuss the reasons proteins were generally...Ch. 10 - Contrast the contributions made to an...
Ch. 10 - When Avery and his colleagues had obtained what...Ch. 10 - Why were 32P and 35S chosen for use in the...Ch. 10 - Does the design of the HersheyChase experiment...Ch. 10 - What observations are consistent with the...Ch. 10 - What are the exceptions to the general rule that...Ch. 10 - Draw the chemical structure of the three...Ch. 10 - How are the carbon and nitrogen atoms of the...Ch. 10 - Adenine may also be named 6-amino purine. How...Ch. 10 - Draw the chemical structure of a dinucleotide...Ch. 10 - Describe the various characteristics of the...Ch. 10 - What evidence did Watson and Crick have at their...Ch. 10 - What might Watson and Crick have concluded had...Ch. 10 - How do covalent bonds differ from hydrogen bonds?...Ch. 10 - List three main differences between DNA and RNA.Ch. 10 - What are the three major types of RNA molecules?...Ch. 10 - How is the absorption of ultraviolet light by DNA...Ch. 10 - What is the physical state of DNA after it is...Ch. 10 - What is the hyperchromic effect? How is it...Ch. 10 - Why is Tm related to base composition?Ch. 10 - What is the chemical basis of molecular...Ch. 10 - What did the WatsonCrick model suggest about the...Ch. 10 - A genetics student was asked to draw the chemical...Ch. 10 - Considering the information in this chapter on B-...Ch. 10 - One of the most common spontaneous lesions that...Ch. 10 - In some organisms, cytosine is methylated at...Ch. 10 - Because of its rapid turnaround time, fluorescent...Ch. 10 - Prob. 31ESPCh. 10 - Newsdate: March 1, 2030. A unique creature has...Ch. 10 - During gel electrophoresis, DNA molecules can...Ch. 10 - DNA and RNA are chemically very similar but are...Ch. 10 - Electrophoresis is an extremely useful procedure...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the Holliday model for homologous recombination shown, the resolution steps can produce recombinant or nonrecombinantchromosomes. Explain how this can occur.arrow_forwardExplain the reason that recombination between similar, but not nonidentical sequences pose a problem for human cells.arrow_forwardA blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using fluorescent primers associated with three STR loci: D3S1358, vWA, and FGA. The resulting electrophoretograms are shown below. The numbers beneath each peak identify the allele (upper box) and the height of the peak in relative fluorescence units (lower box). Solve, (a) Since everyone has two copies of each chromosome and therefore, two alleles of each gene, what accounts for the appearance ofonly one allele at some loci? (b) Which suspect is a possible source of the blood? (c) Could the suspect be identifi ed using just one of the three STR loci? (d) What can you conclude about the amount of DNA obtained from Suspect 1 compared to Suspect 4?arrow_forward
- As the leading scientist in a biomedical science laboratory, it is a requirement to give advice to your lab assistants when they are having problems with their experiments. What advice would you give to your assistants that are having the following problems: After performing a polymerase chain reaction (PCR) and agarose gel electrophoresis to confirm the presence of the C01 gene of 750bp. 2.1. They observe no band appearing on an agarose gel. What would be your conclusion? 2.2. They observe three bands of different sizes that resemble a smear on the gel. Advice 2.3. They observe a single band on the gel and conclude that the PCR product is an exact copy of the original template DNA. Would you support their condusion? Explain. 2.4. Explain how PCR can be used to detect infectious agents in diagnoses of diseases.arrow_forwardDescribe the main technique for amplifying a segment of DNA (like the one you suspect is involved in Lee’s cancer) from a complex mixture of genomic DNA. Remember that the entire human genome sequence is known. (Hint: This is a technique that is commonly used by laboratories that do genetic testing and various other applications of molecular biology.)arrow_forwardA molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’arrow_forward
- The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome (BAC) clones (A–E) is indicated in the following table. Using these markers, put the BAC clones in their correct order and indicate the locations of the numbered sequences within them. Sequences BAC clone 1 2 3 4 5 6 A + − − − + − B − − − + − + C − + + − − − D − − + − + − E + − − + − −arrow_forwardIt is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation. a) List all the steps from cell pellet preparation to DNA elution. b) With which feature can the membrane in the column that comes with the commercial kit bind DNA? c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?arrow_forwardA person with a rare genetic disease has a sample of her chromosomessubjected to in situ hybridization using a probe that is known to recognize band p11 on chromosome 7. Even though her chromosomes look cytologically normal, the probe does not bind to this person’s chromosomes. How would you explain these results? How would you use this information to positionally clone the gene that is related to this disease?arrow_forward
- What is recombination? Mention its applications with reference to genetic engineering.arrow_forwardname some Variety of Methods Can DetectChromosomal Rearrangementsarrow_forwardExplain why phenol:chloroform is used in the isolation of genomic DNA (What is the end result and what must you do for the desired effect)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License