Microbiology: A Systems Approach
5th Edition
ISBN: 9781259706615
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 1, Problem 9MCQ
Order the following items by size, using numbers: 1 = smallest through 8 = largest.
___ adenovirus
___ amoeba
___ rickettsia
___ protein
___ helminths
___ coccus-shaped bacterium
___ white blood cell
___ atom
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Complete the sentences with the matching vocabulary term
Terms:
-lytic
-gram negative
-aerotolerant anaerobe
-ether
-facultative aerobe
-enveloped virus
-prion
-peptidoglycan
-pseudopeptidoglycan
-chemo heterotroph
-obligate intracellular parasite
-facultative anaerobe
-lysogenic
• A ______ bacterium will have a thin cell wall covered with an internal membrane.
• A pathogen that cannot survive outside the host cell is a(n) _____.
• An aerobic organism that can switch to anaerobic respiration when necessary is known as a(n) ______.
• The bacterial cell wall is made of ______.
• A phage that kills the host cell after one round of viral replication is referred to as a _____ phage.
https://www.youtube.com/watch?v=3ivMSCi-Y2Q&feature=emb_logo
https://www.youtube.com/watch?v=q2nWNZ-gixI&feature=emb_logo
what do bobtail squids and bacteria have in common? How can this knowledge be applied to the medical field?
Give a disease-causing pathogen or microbe and answer the following questions.
1. What is the name of the pathogen causing the disease?
2. What disease does the pathogen cause?
3. How is disease transmitted?
4. What are the symptoms of the disease?
5. How long does it last for?
6. Can the disease be treated?
7. Is there a vaccine for the disease?
Chapter 1 Solutions
Microbiology: A Systems Approach
Ch. 1.1 - List the various types of microorganisms.Ch. 1.1 - Identify multiple professions using microbiology.Ch. 1.2 - Describe the role and impact of microbes on the...Ch. 1.2 - Explain the theory of evolution and why it is...Ch. 1.3 - Explain one old way and one new way that humans...Ch. 1.4 - Summarize the relative burden of human disease...Ch. 1.5 - Differentiate among bacteria, archaea, and...Ch. 1.5 - Identify a fourth type of microorganism.Ch. 1.5 - Compare and contrast the relative sizes of the...Ch. 1.6 - Make a time line of the development of...
Ch. 1.6 - List some recent microbiological discoveries of...Ch. 1.6 - Explain what is important about the scientific...Ch. 1.7 - Differentiate among the terms nomenclature,...Ch. 1.7 - Create a mnemonic device for remembering the...Ch. 1.7 - Correctly write the binomial name for a...Ch. 1.7 - Draw a diagram of the three major domains.Ch. 1.7 - Explain the difference between traditional and...Ch. 1 - Which of the following is not considered a...Ch. 1 - Which process involves the deliberate alteration...Ch. 1 - Prob. 3MCQCh. 1 - Prob. 4MCQCh. 1 - Prob. 5MCQCh. 1 - Prob. 6MCQCh. 1 - Which is the correct order of the taxonomic...Ch. 1 - Prob. 8MCQCh. 1 - Order the following items by size, using numbers:...Ch. 1 - How would you classify a virus? a. prokaryotic b....Ch. 1 - Organisms in the same order are more closely...Ch. 1 - Prob. 12TFCh. 1 - Prob. 13TFCh. 1 - Prob. 14TFCh. 1 - Prob. 15TFCh. 1 - Prob. 1CTQCh. 1 - Define the term ubiquitous, and provide examples...Ch. 1 - Differentiate the terms emerging disease and...Ch. 1 - Discuss how the findings of Louis Pasteur may have...Ch. 1 - You are a scientist researching West Nile virus, a...Ch. 1 - Prob. 1VCCh. 1 - Prob. 1CM
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The term _________________________________ means pertaining to a virus. viral virilearrow_forwardMatch the following with the choices on the right Bacteria 1. Eukaryotic photosynthetic organisms that are not plants 2. Nucleic acid in a protein coat 3. An infectious particle that is a protein Archaea Fungi Protozoa Algae Platyhelminthes Nematoda Viruses Viroids 4. Prokaryotes, usually with peptidoglycan Prions cell wallsarrow_forwardImagine that a NEW extremely contagious and deadly disease has swept the Earth. What would society in the aftermath look like? Keep it simple and easy. Write 2 paragraphsarrow_forward
- Bacillus and Clostridium both form ___________________. These resistant structures are found in the dirt and are important for transmission of these microbes. Give a specific explanation of how each of these microbes normally moves from its reservoir in the dirt to enter a host. Anthrax (Hint: Anthrax is sometimes known as “wool-sorter’s” disease) Cutaneous Inhalation/ Pulmonary Ingestion/ Gastrointestinal Tetanus Botulismarrow_forwardChoose the false statement: (Regarding Pasteur’s famous experiment) The swan necked flasks were important because they allowed the broth to remain sterile, while still remaining open to the atmosphere. Pasteur’s work with the swan neck flasks was only of importance to the food industry; his work occurred long before anyone, including Pasteur, had any awareness that diseases could be caused by microscopic agents. The swan necked flasks were used to prove that life could only arise from pre-existing cells.arrow_forwardI studied microbiology in the fifth semester of medical school. I studied medical mycology as one of the sub-divisions of microbiology. Medical mycology covers human diseases caused by protists fungi birds parasites like plasmodium, schistosoma, amoeba insects like lice algaearrow_forward
- Fill in the blank: The bacterium Staphylococcus aureus is ___________ in shape and ______________ in arrangement.arrow_forwardYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forwardWhich of the following is mismatched? Naegleria - protozoan that causes amoebic meningoencephalitis, usually acquired from swimming in warm ponds or lakes African trypanosomiasis (sleeping sickness) - protozoan disease transmitted by Tsetse flies Rickettsia prowazekii - the cause of epidemic typhus transmitted by the human body louse None of the other four answers (All are matched correctly) Cytomegalovirus - a type of herpesvirus that causes fetal infections and retinitis in Acquired Immunodeficiency Syndrome (AIDS) patientsarrow_forward
- Viruses are obligate intracellular parasites. Rubella is also known as Exanthem subitum * FIRST statement is TRUE; SECOND statement is FALSE BOTH Statements are TRUE FIRST statement is FALSE; SECOND statement is TRUE BOTH statements are FALSEarrow_forwardGive typing answer with explanation and conclusion Which of the following are groups of microbes? Select all correct answers. Group of answer choices Bacteria Archaea Chromosomes Fungi Antibodies Viruses Protozoa Plantsarrow_forwardMatch the following genera correctly with the correct characteristic, role, or disease. Vibrio Lactobacillus Streptococcus Leucothrix Escherichia Clostridium Nitrosomonas Rickettsia Legionella Choose one for each : Infect other bacteria Can cause severe food poisoning, especially from improperly canned food Strep throat Normally an important gut microbe but not a probiotic HIV MRSA Typhus Whooping cough Legionnaire's disease Disperse by gonidia Produce antibiotics Bioluminescent Probiotic Important in nitrogen cycle Tetanusarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY