Match the following with the choices on the right Bacteria 1. Eukaryotic photosynthetic organisms that are not plants 2. Nucleic acid in a Archaea Fungi Protozoa Algae Platyhelminthes protein coat 3. An infectious particle that is a protein Nematoda Viruses Viroids 4. Prokaryotes, usually with peptidoglycan Prions cell walls

Match the following with the choices on the right Bacteria 1. Eukaryotic photosynthetic organisms that are not plants 2. Nucleic acid in a Archaea Fungi Protozoa Algae Platyhelminthes protein coat 3. An infectious particle that is a protein Nematoda Viruses Viroids 4. Prokaryotes, usually with peptidoglycan Prions cell walls

Aquaculture Science

3rd Edition

ISBN:9781133558347

Author:Parker

Publisher:Parker

Chapter11: Health Of Aquatic Animals

Section: Chapter Questions

Problem 5KA

See similar textbooks

Similar questions

- Mycoplasma MICROBIO-VIROLOGY advanced have gram positive cell walls are cells with prokaryotic organization are bacteria typically found in contaminated soils. can have intracellular replication. cause skin infections. - Which of the following amino acids has a hydrophobic side chain? BIOCHEMISTRY basic Methionine Glutamine Lysine Serine Glutamic acid - Which of the following is true regarding viruses? MICROBIO-VIROLOGY basic Released viral particles during cell lysis or budding arecalled virions. Viruses have a protein capsid and an envelope. Viruses are obligate intracellular parasites. Virus genome can be DNA, RNA, single or double stranded. Outside the host, viruses are inactivated within 24 hours. - On the respiratory system what are the correct statements? PHYSIOLOGY basic Partial pressure of carbon dioxide (pCO2) is higher in alveoli than in atmospheric air. Surfactant reduces surface tension within the alveoli Elastic recoil of the lungs…
Flagellated microbe, a mutualist found in termite intestines, makes cellulase O Taenia_ O Trichomonas_ Trypanosoma_ O Trichophyton_ Trichonympha_
Clostridium difficile infection is the leading causeof hospital-associated gastrointestinal illness. It is typicallytreated with a course of antibiotics, but the infection recursin about 20% of cases. C. difficile infections are difficult toeradicate because the bacteria exist in two forms: a repli-cating, toxin-producing form and a spore form that is resis-tant to antibiotics. Fecal microbiota transplantation—thetransfer of normal gut microbiota from a healthy individ-ual—can resolve >90% of recurrent infections, a much bet-ter cure rate than further antibiotic treatment alone. Whydo you suppose microbiota transplantation is so effective?
Match pathogen to common site of hospital-acquired infection. Make matches so you use each letter one time. 33. forms endospores, causes serious diarrhea Resistant Staphylococcus Aureus A. Methicillin- 34. gram-negative opportunist, burn infections, pneumonia difficile 35. typical large intestine flora, causes urinary tract infections 36. broadly antibiotic-resistant, causes infections anywhere in body aeruginosa B. Clostridium C. Escherichia coli D. Pseudomonas 37. If a disease can use in a room where air does not freely flow out of the room. transmission, a patient with that disease will need to be A. droplet B. contact C. airborne D. fecal-oral 38. Handwashing will not prevent transmission of a pathogen. A. direct contact B. fomite C. vector D. fecal-oral 39- A 27-year old unmarried female patient presents with genital warts. A-Which one of the following viruses is the most likely cause? 1- Herpes simplex virus 2- Epstein-Barr virus 3- Hanta virus 4-HPV S-HIV B- Which one of the…
What structures are found on agar plates when the bacteriophage T4 has penetrated Escherichia col? O colonies color change no color change plaques
Select all statements that are true regarding members of the genus Mycobacterium. O They contain mycolic acids O They can cause tuberculosis O One species causes tuberculosis O They are proteobactria O They are practically impenetrable by antibiotics O Their cell walls lack peptidoglycan O They are easy and fast to grow under laboratory conditions
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
T of 3 eBook eferences Home x Mc Graw Hill Take X mheducation.com/ext/map/index.html?_con=con&external_browser=0&launchUrl=https%253A%252F%252Fblackboard.matc.edu%252Fwebapps% Required information The viral capsid @ 2 W Multiple Choice → #3 Conte x engulfs the viral spikes. surrounds the viral matrix protein. e с Home x $ 54 r becomes completely enclosed by the region of the cell membrane into which the spikes and matrix protein are embedded. * 816 N X 8 O 1 Quest x 9 ✓ O Help
The rough strain of Streptococcus pneumonia is not pathogenic because it lacks the present on the pathogenic smooth strain of Streptococcus pneumoniae. cell wall O endospore capsule gas vesicles peptidoglycan flagellum
A boy with advanced Duchenne muscular dystrophy developedpulmonary edema (accumulation of fluid in the lungs) and pneumoniacaused by a bacterial infection. His physician diagnosed the conditionin the following way: The pulmonary edema was the result of heartfailure, and the increased fluid in the lungs provided a site wherebacteria could invade and grow. The fact that the boy could notbreathe deeply or cough effectively made the condition worse. Howwould the muscle tissues in a boy with advanced DMD differ from themuscle tissues in a boy with less advanced DMD?
Which of the following are antibiotics? X-gal and IPTG haemolysin Escherichia coli pBluescript EcoRI DH5α kanamycin ampicillin pK184 PstI hlyA.
CAN Corynebacterium diphtheriae be infected by a viruses. I know it is a bacteria but I need to know if it is possible for it to be infected by a virus. Please be specific but in terms that is easy to understand. PLEASE answer this specif question. I don't need to know the causes, effects, outcomes, etc of Corynebacterium diphtheriae. I already know that stuff, I need this specific question answered. THANK YOU.