SCIENTIFIC INQUIRY Knowing that the genetic code is almostuniversal, a scientist uses molecular biological methods toinsert the human β-globin gene (shown in Figure 17.12) intobacterial cells, hoping the cells will express it and synthesizefunctional β-globin protein. Instead, the protein produced isnonfunctional and is found to contain many fewer amino acidsthan does β-globin made by a eukaryotic cell. Explain why

SCIENTIFIC INQUIRY Knowing that the genetic code is almostuniversal, a scientist uses molecular biological methods toinsert the human β-globin gene (shown in Figure 17.12) intobacterial cells, hoping the cells will express it and synthesizefunctional β-globin protein. Instead, the protein produced isnonfunctional and is found to contain many fewer amino acidsthan does β-globin made by a eukaryotic cell. Explain why

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 3VCQ: Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks...

See similar textbooks

Similar questions

10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis? Tetracycline would directly affect: tRNA binding to the ribosome ribosome assembly growth of the protein chain Chloramphenicol would directly affect tRNA binding to the ribosome ribosome assembly growth of the protein chain
In the presence of cephalosphorin, what will be the protein product of the prokaryotic cell gene shown below? 5'-CATGTCAGTAAGGCATCT-3' (Assume this is a segment of a larger structural gene that will be translated into protein in its entirety.)
DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).
Predict the amino acid sequence produced during translationof the short theoretical mRNA sequences below. (Notethat the second sequence was formed from the first by a deletionof only one nucleotide.) What type of mutation gave rise tosequence 2? Sequence 1: 5'@AUGCCGGAUUAUAGUUGA@3' Sequence 2: 5'@AUGCCGGAUUAAGUUGA@3'
Locate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA synthetase; (u) hydrogen bond; (v) exon; (w) 5′ AUG 3′; (x) potential wobble interaction.
Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…
In the: The 6 factor that does not dissociate from the RNA polymerase Holoenzyme Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?
DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Order+the+following+of+protein+sentesis+sequence+from+earliest: (a)tRNA molecule bring specific amino acids to he mRNA molecule. b)mRNA nucleotides join with exposed DNA bases and form a molecule of mRNA.(c)The two stands of a DNA molecule separate. (d)Peptide bonds form between the amino acids. (e)the mRNA molecule leave the nucleus. (f) a ribosome attached to the mRNA molecule.