Q: List some errors that can come from hemocytometer? 5) List some errors that can be introduced from a…
A: Errors that can arise from a hemocytometer include:Incorrect Volume MeasurementUneven Distribution…
Q: Allowing all drunk-driving suspects (driving erratically) to complete the above sobriety test in 60…
A: The question is asking about the potential effects of extending the time allowed for a sobriety test…
Q: Explain why proteins can take on so many different functions in living things.
A: Proteins are biomolecules that play an important role in the functioning of living organisms. They…
Q: House mouse (Mus musculus) Gene of interest: B4galnt2 (encodes glycosyltransferase enzyme) • Allele…
A: The objective of the question is to predict the change in the frequency of the R allele in a mouse…
Q: In a species of roses, the alleles RP and RR code for pink roses and red roses, respectively. In…
A: Paramutation represents a unique interaction between alleles where one allele induces a heritable…
Q: What is the one-word term for the structure indicated by the letter B?
A: SEPALExplanation:Detailed explanation: The structure that is labelled B is called a sepal. Sepal…
Q: Erasistratus from Ceos identified the correct function (to prevent backward flow of blood from the…
A: The objective of the question is to identify the valve in the human heart that prevents the backward…
Q: In your response explain how your species communication would potentially enhance the fitness of…
A: The question asks you to explain how your species' communication could potentially enhance the…
Q: How can some bacteria become resistant to antimicrobial drugs?
A: Bacteria can develop resistance to antimicrobial drugs through various mechanisms, including:…
Q: Scientific research grant proposal outline on coral reef used for cancer
A: 1. IntroductionBriefly discuss the global burden of cancer and the urgent need for novel…
Q: CELL DIVISION METAPHASE Describe the event(s) occurring during this part of the cell cycle... Match…
A: Metaphase is a critical stage of the cell cycle that occurs after prophase but before anaphase. It…
Q: Label the cell below
A: The objective of the question is to identify the part of the cell that controls the movement of…
Q: Helper T cells do not _________. Select one: a. secrete cytokines that stimulate clonal selection…
A: The question is asking us to identify the function that Helper T cells do not perform.
Q: vvnich of these are true about bone marrow? There may be more than one correct answer. Large numbers…
A: Bone marrow is a tissue found within some of our bones. It plays a critical role in our health by…
Q: 6. The CO2 released when we exhale is produced by:a) Glycolysis (glucose to pyruvate)b)…
A: The objective of the question is to identify the biological process that leads to the production of…
Q: Please answer the following question and explain Q1. If MacLeod and McCarty had accidentally…
A: DNA - All genetic information is carried by deoxyribonucleic acid, or DNA. It codes genetic…
Q: expand this into 1000 words. the context is Identification of Differentially Expressed Genes in…
A: Step 1. Genomics in the diagnostics of breast cancer is an important aspect of its complexity and…
Q: please answer part a
A: a).The ratio of the concentrations of HPO42− to H2PO4− ions in the phosphate buffer system must be…
Q: In the podcast on how to read a scientific paper what did Prof Fraser and Prof Clare conclude about…
A: Prof. Fraser and Prof. Clare's podcast on how to read a scientific publication provides excellent…
Q: A two-month old child was admitted to hospital after failure to thrive. The “boy”, whose external…
A: Congenital adrenal hyperplasia (CAH) is a group of genetic disorders that affect the adrenal glands'…
Q: If 70% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 30…
A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…
Q: Isoprene serves as a building block not only for the hydrocarbons observed in archaeal membranes but…
A: Isoprene is a five-carbon, branched molecule and its chemical name is 2-methyl-1,3-butadiene. The…
Q: What type of allele dominance is expressed in each of the Punnet Squares shown. Complete dominance,…
A: Allele dominance patterns affect how these traits are expressed in offspring and are essential in…
Q: What drives the rotation of the F1 head (rotor) of ATP synthase? a. proton movement from…
A: The question is asking about the mechanism that drives the rotation of the F1 head, also known as…
Q: A biologist hypothesizes that habitat fragmentation and loss has led to a more clustered…
A: Biological statistical analysis is the application of statistics to analyze data in biology. It's a…
Q: Two opposing mechanisms determine alveolar expansion:_________ leads to alveolar expansion,…
A: The objective of the question is to identify the two opposing mechanisms that determine alveolar…
Q: House mouse (Mus musculus) Gene of interest: B4galnt2 (encodes glycosyltransferase enzyme) • Allele…
A: The objective of the question is to predict the change in the frequency of the R allele in a mouse…
Q: Write a set of directions for a red blood cell to deliver oxygen to the brain. Include all the words…
A: The most prevalent form of blood cell, red blood cells, scientifically defined as erythrocytes, are…
Q: your breakfast cereal more likely to be measured in grams or liters? (Please correct answer and all…
A: Breakfast cereals are commonly made with corn, rice, oats, and wheat. These are eaten in the form of…
Q: Herophilus from Chalcedon identified how many chambers in the human heart? 6 chambers: the right…
A: The question is asking about the number of chambers in the human heart that were identified by…
Q: The theory endosymbiosis is important in understanding how mitochondria and eukaryotic cells may…
A: Lynn Margulis propounded the endosymbiotic theory. According to this theory eukaryotic cells…
Q: Which of the following are components of the hepatic portal system? Select one: a. Azygos vein b.…
A: The objective of the question is to identify the components of the hepatic portal system from the…
Q: A linkage map shows the distance between gene 'a' and gene 'b' to be 40CM, how many of each genotype…
A: Punnett Square Geneticslinkage map shows that the distance between gene a and gene b is 40…
Q: Switchgrass is used for ethanol production. The composition of the switchgrass is 37% cellulose, 24%…
A: Lignocellulosic Sugar Production:Glucose: 370 kgXylose: 240 kgGalactose: 30 kgArabinose: 40…
Q: Compare and contrast various types of pasteurization technique, considering the temperature and…
A: Pasteurization is a process named after the French scientist Louis Pasteur, fundamentally utilized…
Q: Who would you expect to be most at risk for developing the bone disease rickets? A) Children born to…
A: The objective of the question is to identify the group of people who are most at risk for developing…
Q: How are amino acids grouped together? What properties do these groups have?
A: Amino acids are the building blocks of proteins, and they are classified into groups based on the…
Q: Miriam goes on a hunger strike and enters into starvation. This would result in: Group of answer…
A: When an individual goes on a hunger strike and enters into a state of starvation, their body…
Q: The lowest rate of blood flow occurs at this roman numeral on the figure: 5000 4000 3000 2000 1000 0…
A: The lowest rate of blood flow occurs at Roman numeral II on the figure. This corresponds to the…
Q: ) If you counted 500 CFU’s in the 7th tube how many CFU’s you should expect in the 9th test tube?…
A: To answer these questions, we need to understand CFU (Colony Forming Units) and how they relate to…
Q: A mutagen is an agent that increases the possibility of a mutation and a carcinogen is an…
A: Mutations can occur spontaneously or be induced by various factors, including mutagens. However, not…
Q: Chemical bond energy: Is the energy used by photosynthesis for the fixation of carbon Is generated…
A: The question is asking us to identify the correct statement(s) about chemical bond energy. Chemical…
Q: Please do the following on the topic of Alcohol: -Identify type of pathway of your choosing(Neural…
A: Understanding alcohol's impact on the body's physiological frameworks could be a tremendous and…
Q: Which of the following are mechanisms to prevent food from entering the larynx? (Check all that…
A: The objective of the question is to identify the mechanisms that prevent food from entering the…
Q: When does the process of meiosis happen in your lifetime?
A: The objective of the question is to understand when the process of meiosis, a type of cell division…
Q: Crossmatching donor red cells for a patient involves combining: Question 2 options:…
A: The objective of the question is to identify the correct procedure for crossmatching donor red cells…
Q: Sickle Cell Anemia is an example of "balancing selection" in which natural selection works against…
A: The objective of the question is to determine whether Sickle Cell Anemia is an example of 'balancing…
Q: The ploidy of this structure is Haploid Gametophyte Diploid Sporophyte
A: The ploidy of this structure is Gametophyte.Explanation:Let's delve deeper into the concept of…
Q: The vasa vasorum Select one: a. are special capillaries that supply nutrients to the walls of…
A: The objective of the question is to identify the correct definition of the term 'vasa vasorum'.
Q: Match the cell organelle with its function. Put responses in the correct input to answer…
A: The objective of the question is to match each cell organelle with its corresponding function.
If the mRNA sequence is ATG GGG AGC
What is the anticodon sequence?
Step by step
Solved in 1 steps
- 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this geneUCA CAG AAA CUG How many amino acids does the mRNA strand above code for?TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype
- ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.Explain The mRNA codon of valine is: GUC UGG CCA TTGw/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf
- What is thee tRNA anticodon for the first 5’-ACGAUC-3’?mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.
- GAC UAU GCG GGA GGO AAG CA UGA iwhat is The auino a cid that would Lesult from this m RNA SeepuenU?Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC GCG CGG UAA-3'Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'