C a 3' 5' exon intron exon intron exon intron untranslated region (UTR) coding sequence (CDS) Label each of the features of the gene pictured (a, b, c, and d).

For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'

Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part 1 of 5 What amino acid sequence is coded for by this mRNA? Leu-Thr-Asp Part 2 of 5 What is the amino acid sequence if a mutation converts UUG to UUA? Leu-Thr-Asp Part 3 of 5 What is the amino acid sequence if a mutation converts ACC to AGC? Leu-Ser-Asp Part 4 of 5 What is the amino acid sequence if a mutation converts GAC to CACT Leu-Thr-His Part: 4/5 Part 5 of 5 What is the amino acid sequence if G is added to the beginning of the chain? x S

MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene. The TATA box and kozak sequences are shown in parenthesis. Wild-type: 5’-ATGGCC​[TATAT]ATGTCACTTGACTACGCAGCC​[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ What is the resulting polypeptide from the wild-type protein?