Which of the lettered arrows in thediagram of translation indicates anamino acid?A/G|G AAUGGGAC Which of the following codons codes forthe same amino acid as the codon AGU?The genetic codeSecond letter of codonAJU Phenylalanine UCUUAUUACU Stop codon1Ux Stop codonCAUHistidine (His)Tyrosine (Tyr)UGUUGCUUC Phe)UUAUUGCUUCUCCysteine (Cys)[OG Stop codonUGS Tryptophan (Trp)UCC Serine (Ser)UCALeucine (Leu)CCUCGUccCCCArginine (Arg)CGACACLeucine (Leu)Proline (Pro)CCACAAGlutamine (Gin)CAGCUACUGAUUAUCAUAccaACUsoleucine le)ACCAAUAGU Serine (Ser)AGCAsparagine (Asn)Lysine (Lys)AACThreonine (Thr)ACAMethionine:ACCstart codonGCUAAAAGAArginine (Arg)ARCAGSGUUGUCGAU Aspartic acid (Asp)ouGGCGGAGAA Glutamic acid (Glu)GGGValine (Val)GCC Alanine (Aba)GACGlycine (Gly)GCAGUAGUGGAGAGACGUUCAGCUFirst letter of codonThird letter of codon

The method of making a protein from the information found in a molecule of messenger RNA is known as…

Answered: Which of the lettered arrows in the…

Science

Biology

Which of the lettered arrows in the diagram of translation indicates an amino acid?

Medical Terminology for Health Professions, Spiral bound Version (MindTap Course List)

8th Edition

ISBN:9781305634350

Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Publisher:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Chapter6: The Lymphatic And Immune Systems

Section: Chapter Questions

Problem 42LE

See similar textbooks

Related questions

Q: Which of the following statements about RNA are true?

Q: Which of these statements is true about the elongation step of translation? O The growing…

A: Translation is the process by which the triplet base sequence of an mRNA guides the linking of a…

Q: The ribosome binds to the mRNA molecule to start translation of its code into a protein. What…

A: Step 1 The translation is the process in which the coded genetic message brought by mRNA (messenger…

Q: A monomeric protein contains 154 amino acids. How many codons code for these amino acids? How many…

A: Amino acids are joined by peptide bonds to form a polypeptide. A protien is a polymer of many…

Q: What are the blockers of translation?

A: Introduction: Translation is the process in which there is formation of a polypeptide chain from…

Q: Which of the following amino acids is not formed after post-translational modification? A.…

A: Post translational modification is the covalent modification of protein after Protein synthesis.…

Q: A. What organelle is responsible for Translation?

A: Protein synthesis is the process of creating protein molecules. It involves amino acid synthesis,…

Q: Which of the following is not directly involved in translation?

A: Translation is the cycle where ribosomes present in the cytoplasm or endoplasmic reticulum blend…

Q: In a detailed diagram show and explain all the locations where RNA may regulate protein translation.…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: in not more than five sentences, compare and contrast prokaryotic from eukaryotic translation.…

A: In molecular biology, translation is the process, where mRNA is decoded to the polypeptide chain or…

Q: To begin translation, the small subunit of the ribosome starts moving down an mRNA. What feature…

A: INTRODUCTION Translation Translation is the process of conversion of mRNA into protein. It consist…

Q: In translation, the information in a mRNA transcript is used to build a polypeptide chain (protein).…

A: Translation the cellular process of formation of a polypeptide chain from the amino acids coded by…

Q: Where does translation occur in this diagram

A: Translation is the process by which messenger rna is getting translated into proteins .

Q: What is the role of tRNA in translation?

A: During translation the genetic information which is present in mRNA directs the order of specific…

Q: Label the 5' and 3' ends of DNA and RNA and the amino and carboxyl ends of the protein. Assume it is…

A: DNA is the genetic material in all the living cells.

Q: Why would translation not work if ribosomes could bind only one tRNA at a time?

A: According to the central dogma of the molecular theory, the information stored in the DNA is first…

Q: If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read…

A: Protein synthesis is described as the process that ultimately results in the formation of proteins.…

Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…

A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…

Q: Why must a polypeptide sequence begin with a designated Start codon?

A: There is an intimate connection between genes and synthesis of polypeptides or enzymes. Genes are…

Q: Describe protein biosynthesis. Define transcription and translation. What enzyme…

A: The cell biology is considered as the study of cells, their structure, and their functions. The…

Q: Which term describes each of these steps or substeps in the translation process? The ribosome shifts…

Q: peptide bond formation in translation occurs by ....

A: Proteins are the main products of translation. They are made up of chains of amino acids connected…

Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…

A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…

Q: Draw the structure of translation?

A: The process of conversion of information stored in the mRNA into a protein is called translation.…

Q: Using seven numbered steps, describe the process of translation.

A: Translation : It is the process of translating the sequence of mRNA molecule to a sequence of amino…

Q: List two essential role of ribosomes during translation?

A: Ribosome is a membrane less cell organelle which contains two sub-units, one .large and one small.

Q: What are the major differences between translation in bacteriaand translation in eukaryotes?

A: The translation is considered as the process, in which an RNA sequence is required to synthesize…

Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation?*

A: A termination codon or a stop codon is a group of three amino acids that is present in the mRNA that…

Q: For one ribosome-specific antibiotic, identify the specific step in translation that it blocks?

A: Drugs that are used to treat microbial infections are commonly referred to as antimicrobial agents.…

Q: how many polypeptide chain is the product of translation?

A: Amino acids are the building blocks of proteins, and each amino acid has a specific structure. The…

Q: What would the peptide sequence be like after translation?

A: Translation is the process by which polypeptide or protein is produced from the mRNA by the help of…

Q: Look at the codon "UUU" in the codon chart. If the 3rd nucleotide (3rd Uracil) was mutated to a "C"…

A: The genetic code is triplet code called codon.The genetic code is degenerate meaning that given…

Q: The base sequence of which type of RNA is responsiblefor determining the order of amino acids in a…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: Why do ribosomes move along mRNA during translation?

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: Difference between translation in prokaryotes and eukaryotes?

A: The translation process can also be called protein synthesis. It involves translating the genetic…

Q: What kind of bond is created between successive amino acids in a protein? If there are more codon…

A: Proteins are made up of chemical 'building blocks' called amino acids. Nucleotide is the basic…

Q: What are the function of initiation,elongation,termination in case of translation?

A: The process of translation is characterized by the process of gene expression. In this process, mRNA…

Q: What is the order of the polypeptide chain shown in the images provided? Starting at the…

A: Translation is the process of synthesizing proteins from RNA template through series of reactions on…

Q: What amino acid sequence will be generated, based on the following MRNA codon sequence? 5' AUG- UCU-…

A: The genetic code is the precise sequence of DNA nucleotides interpreted as three-letter words or…

Q: Which of the following statements about bacterial translation is FALSE? O A. The arrangement of key…

A: A) The ribosomes have the two subunits of the rRNA and the proteins, a large subunit with the three…

Q: Show the neat structure of translation?

A: The process of conversion of information stored in the mRNA into a protein is called translation.…

Q: Which translation protein mimics RNA structures and why?

A: Gene expression is defined as the process of conversion of information stored in the DNA to the…

Q: What is translation

A: Protein synthesis is important as it does various functions in each cell. Without protein, cells…

Q: Which of these statements is true about the elongation step of translation? The growing polypeptide…

A: Translation is the process of translating the sequence of a messenger RNA molecule to a sequence of…

Q: Describe the steps of translation initiation,elongation, and termination.

A: Introduction:- The process of forming a polypeptide chain from mRNA codons is known as translation…

Q: Amino acids are brought to the site of translation by what molecule? Where in the cell does…

A: Translation is the process by which proteins are synthesized by the ribosomes present in the…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

Which of the lettered arrows in the
diagram of translation indicates an
amino acid?
A/G|G A
AUGGG
A
C

Which of the following codons codes for
the same amino acid as the codon AGU?
The genetic code
Second letter of codon
A
JU Phenylalanine UCU
UAU
UAC
U Stop codon
1Ux Stop codon
CAU
Histidine (His)
Tyrosine (Tyr)
UGU
UGC
UUC Phe)
UUA
UUG
CUU
CUC
Cysteine (Cys)
[OG Stop codon
UGS Tryptophan (Trp)
UCC Serine (Ser)
UCA
Leucine (Leu)
CCU
CGU
ccC
CC
Arginine (Arg)
CGA
CAC
Leucine (Leu)
Proline (Pro)
CCA
CAA
Glutamine (Gin)
CAG
CUA
CUG
AUU
AUC
AUA
cca
ACU
soleucine le)
ACC
AAU
AGU Serine (Ser)
AGC
Asparagine (Asn)
Lysine (Lys)
AAC
Threonine (Thr)
ACA
Methionine:
ACC
start codon
GCU
AAA
AGA
Arginine (Arg)
ARC
AGS
GUU
GUC
GAU Aspartic acid (Asp)ou
GGC
GGA
GAA Glutamic acid (Glu)
GGG
Valine (Val)
GCC Alanine (Aba)
GAC
Glycine (Gly)
GCA
GUA
GUG
GAG
AGA
CGU
UCA
GCU
First letter of codon
Third letter of codon

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction:

VIEW

Step 2 Concept:

VIEW

Step 3 Concept:

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Draw the peptide provided in its most protonated form. (Upload your answer.) Arg - Cys - Asp - Val
Suppose the codon sequence GUGCAAUUCGAGGCC has a single base pair mutation to GUGCAAUUCAAGGCC. If the old protein sequence was Val-Gln-Phe-Glu-Ala, what will be the new sequence encoded by the mutant gene? ____________________________.
5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.
5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
Which amino acid is coded by the mRNA codes UUG
The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine Threonine
Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: ATG CGC ТСС САТ стт ААС АAА GAG GTT GG C TAT TT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: АTG CGC ТСС САТ стТ ААС АAG GAG GTT GGC ТАТ ТТT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe missense nonsense frame-shift silent antisense
DNAT A C C G C C C C A T G A T G A A T A C C G G G A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTC. Then list in order the amino acids coded by this sequence: mRNA ________________________________________________________________ Amino acids _____________________________________________________________
PLEASE MAKE THE DR BRUJIN GRAPH From these k-mers construct a de Bruijn graph and determine the sequence of the contig. AGCG ATCT ATGA ATGG ATTC CCCT CCTG CTCT CTGA CTGC CTTT GAAG GATT GCGT GCTC GTTC TATG TCAT TCTA TCTT TGAA TGAT TGGA TGTT TTCA TTCC TTTC
This question refers to the mRNA sequence below: 5'-AGCUG AUGGGCUGGUGCCGAGAAAGUUAGGUA A-3' What is the name of the third amino acid in the protein formed from this mRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.