Which of the following statements about base editing is correct? 1. It involves nCas9. 2. The end result of the complete process is the conversion of GC to CU. 3. The "chemistry on the genome" is performed by deaminase. 4. UGI is fused to Cas9 in order to prevent any DNA repair from occurring. O A. 1, 2 and 3 B. 1 and 3 O C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correct

Which of the following regions of the DNA is transcribed by RNA polymerase AND is “understood” by the cell as RNA? [Note: the answer must satisfy BOTH criteria underlined].   1.  Terminator 2.  Poly A tail 3.  5’ and 3’ splice sites 4. -10/-35 promoter sites   A.  1, 2 and 3   B.  1 and 3   C.  2 and 4   D.  4 only   E. All of 1, 2, 3 and 4 are correct

Which of the following mutation description refers to the transversions type? a. Single base change where a A is replaced by C b. Single base change where A is replaced by G c. Single base change where C is replaced by T

Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C. MRDMW-

Which of these statements is correct regarding the CRISPR/Cas9 system in eukaryotic cells? A.Single guide RNA (sgRNA) is used to target specific DNA sequences and activate Cas. B.Bacteriophages are used to inject viral genes into the cell to activated the Cas protein. C.CRISPR takes advantage of the cell’s DNA polymerase proof-reading activities for DNA replication errors D.The CRISPR-Cas system can only be used to alter genomes in prokaryotic cells. E. Cas cuts directly into palindromic restriction sites that it targets in the DNA.

1. Identify the three protein complexes/enzymes important in eukaryotic DNA replication A. Enhancer, silencer, promoter  B. DNA polymerase, RNA polymerase, mediator C. Start codon, stop codon, RNA polymerase D. Prereplication complex, origin recognition complex, MCM helicase

50.

4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA. A.Adenovirus DNA hybridization B.Complementation C.Mutagenesis D.Sequencing 1 分 5 In 1998 Fire, Mellow and coworkers discovered that in C. elgans: A.long double-stranded RNAs can cause sequence-specific gene silencing B.short single-stranded RNAs can cause nonspecific gene silencing C.double-stranded RNAs of any length can cause nonspecific gene silencing D.long single-stranded RNAs can cause sequence-specific gene silencing 1 分 6 RNAi seldomly spreads to: A.the neurons B.the liver C.the brain D.the heart

In bacterial RNA polymerase, the sigma factor A. contains the catalytic activity of the polymerase  B. remains part of the polymerase throughout transciption. C. recognizes promoter sites in the DNA  D. recognizes transcription termination sites in the DNA E. is a subunit of DNA polymerase III

5.A. Draw a wild-type replication fork showing leading and lagging strands and their 5 to 3' direction of synthesis (arrow). B. Draw a replication fork in a RNA primase mutant (no RNA primase function). C. Draw a replication fork in a DNA helicase mutant. D. Draw a replication fork in a DNA polymerase mutant that lacks the proofreading function (but possesses all the other DNA polymerase functions).