83) The RDRP of the rotavirus a. Only produced in the first round of translation b. It is responsible to for the production of both the negative and positive sense strands of the dsRNA genome. c. Is working on the positive strand of the genomic RNA to produce the mRNA d. Is produced only in the second round of translation.

Q: 69) in the first round of translation in Sheeppoxviruses the products are a. the proteins go back to…

A: * sheep pox also known as variola which is an  highly contagious disease of sheep due to a poxvirus…

Q: Although the specific mechanism of RNA interference has not been fully defined, it involves A. the…

A: The RNA interference works at the post transcriptional level because it occurs after the synthesis…

Q: A terminator loop is… Group of answer choices a. A tertiary structure in DNA that causes DNA…

A: Introduction :- There are three main steps , that are present in any molecular events , like - in…

Q: What happens when EF-Tu is mutated A. Be involved in transcription instead of translation B.…

A:

Q: 24. TRUE or FALSE: A microRNA (in red) binds to its mRNA target (black) as shown below:…

A: False  The target will be cleaved.

Q: A particular mature miRNA (microRNA) in mice has sequence 5'-UUCCCUGAGACCUCAAGUGUGA-3'. a. If you…

A: Answer a) ii and iii ii) mRNA sequence complementary to the miRNA sequence iii) miRNA sequence with…

Q: Formation of the 70S ribosomal initiation complex for prokaryotic translation requires A. Mn2+ B.…

A: The production of proteins made up of amino acids is a step in the translation process in cells.…

Q: What is the mechanism by which an RNA transcript can be used to silence expression of the same gene?…

A: Recombinant DNA technology (rDNA technology) is very helpful for analyzing the entire genome of a…

Q: A. RNA polymerase does not require a template. B. all RNA is synthesiud in the nucleolus. C.…

A: Transcription is a process, during which RNA strand is synthesized over the DNA.

Q: The RNA-induced silencing complex (RISC) _____ i. Binds to and unwinds ds siRNA/miRNA to produce…

A: The answet is b. II only RNA-induced silencing complex(RISC) is a multiprotein complex which…

Q: he bands indicated by arrow "A" (to the left of the western blot) most likely represent:   A.…

A: The bands indicated by arrow "A" (to the left of the western blot) most likely represent:-

Q: Bacterial RNA that can act both as an mRNA and a tRNA Group of answer choices a.Micro RNA b.Guide…

A: The gene that a eukaryotic cell turns "on" to a great extent decide its personality and properties.…

Q: A promoter is, choose the correct answer... a. the binding site for the ribosome on a messenger RNA…

A: Transcription is a process in which a transcript ( RNA ) is formed. It takes place by the common…

Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…

A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…

Q: If we watched a eukaryotic cell initiate translation, one of the first things we would see is   a.…

A: Transcription is the process by which the information in the gene is coded into a mRNA (messenger…

Q: or s The diagram above illustrates the process of statement) Row А. B. C. D. i translation…

A: Translation is the process by which RNA is used to make proteins.Transcription is the process of…

Q: miRNAS P. are synthesized as long pri-miRNAs (up to 1000 nucleotides). Q. are transcribed by RNA…

A: Micro RNAs are found in animals, plants and some viruses. These are single stranded RNA molecule…

Q: 38) Termination     begins when there is an AUG at the A site     begins with a termination codon…

A: Termination is the final step in the translation process. When a stop codon (UAA, UAG, or UGA) in…

Q: For a riboswitch that controls transcription, the binding of a small molecule such as TPP controls…

A: Bacteria are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…

Q: Mutation of which of these sequences would have an effect on translational initiation?   A. 3’ UTR…

A: Introduction  Prokaryotic transcription is the process by which prokaryotic genetic material is…

Q: Which of the following is an intron and intergenic coded long transcripts, processed into stem and…

A: RNA (ribonucleic acid) is transcribed from DNA. It is also a genetic material in some…

Q: please arrange the statements in rpoper order

A: RISC  is an RNA-induced gene silencing complex. Argonaute proteins are endonucleases, the active…

Q: If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not…

A: Eukaryotes contains multiple RNA polymerases that transcribes distinct classes of genes. They do not…

Q: Which of the following types of posttranscriptional modification is for mRNA only? a.splicing…

A: Basically, RNA are of following 3 types mRNA - transcribed by RNA pol ll rRNA- transcribed by RNA…

Q: Which of the following is NOT a component of the 30S initiation complex? A. EF-Tu and EF-Ts B.…

A: Translation Translation involves the transfer of information in mrna molecules into the aminoacidsl…

Q: a. CRISPR-Cas9 is a valuable biotechnology tool. Explain how this system uses RNA and the result of…

A: CRISPR-Cas9  is known as unique biotechnology tool which allows medical researchers and geneticists…

Q: The main target for Cas9 to cleave is:

A: Cas9 /CRISPR 9 (Clustered regularly interspaced short palindromic repeat for protein 9)  is a…

Q: The transcription initiation factor “recruited” together with RNA-Pol II in the formation of…

A: Transcription is a process of making an RNA copy from a gene’s DNA sequence. This is known as…

Q: Assembly of transcription initiation complexes is mainly controlled by

A: Assembly of transcription initiation complex is a process of bringing together all the components…

Q: The RNA-induced silencing complex (RISC) I. binds to and unwinds ds siRNA/MIRNA to produce ss…

A:

Q: 87) For a the viral proteins a. If the viral protein is made in the RER, it will go back to the…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Which of the following activities DOES NOT happen during the initiation stage of transcription? A.…

A: Introduction :- The poly-A tail is a stretch of adenine nucleotides that is added to the 3' end of a…

Q: 46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA…

A: Ribosomes are the protein factories of the cell. These are responsible for protein synthesis by…

Q: Your investors are concerned that the GasP protein might not be sufficiently produced under normal…

A: Answer a. As the transcription of GasP protein has been 'triggered' by some chemical (abiotic…

Q: RNA processing events include A. self splicing B. methylation of 45S FRNA C. snoRNA facilitates…

A: Introduction: RNA processing involves newly transcribed RNA molecules (primary transcript)…

Q: Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds…

A: Gene is present on a chromosome and contains hereditary information. These genes are later…

Q: Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes…

A: RNA Polymerase II is responsible for the transcription of messenger RNA with the help of DNA. For…

Q: The RNA-induced silencing comp (RISC) I. binds to and unwinds ds siRNA/miRNA to produce ss…

A: A multiprotein complex called RISC contains one string of a small interfering RNA (siRNA) or micro…

Q: 26. Synthesis of a repressible enzyme is stopped by a the allosteric transition b. the substrate…

A: In the regulation of gene expression, various mechanisms come into play to control the activity of…

Q: Histone deacetylase (HDAC) enzymes   a.Promote initiation of translation. b.Complex with…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: Eukaryotic mRNAs a. require processing to produce mature mRNAs b. do not require processing to…

A: Answer of the question given below...

Q: Explain the different events under post transcriptional modification. A. 5'capping B.…

A: Post-transcriptional modification, also known as co-transcriptional modification, is a series of…

Q: When an ncRNA functions as a decoy, ita. contains binding sites for many different proteins,…

A: Non-coding RNA (ncRNA) refer to the RNA molecules that are not translated into proteins. The…

Q: microRNAs (miRNAs) play important roles in gene regulation. What is the correct order of steps…

A: A class of short, endogenous RNAs with a length of 21–25 nucleotides (nts) is known as microRNAs…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.