II. Identify what the mRNA, tRNA and amino acid for the DNA bases below. DNA bases below can be translated to become the amino acid present in a cow. DNA bases mRNA (Transcripion) TRNA Codons (Translation) Amino Acids 1. CÁC 2. AAA 3. АСА 4. ATG 5. АТА 6. TTA 7. GTA 8. TTC 9. ТСС 10. ACT
Q: In problem 2e, how can you identify added mutations?
A: Mutations are changes in the base pairs of DNA that are heritable to the offspring. Mutations caused…
Q: II. Do what is asked A. 1. a. Use the codon given below to complete the following table. Assume that…
A:
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…
A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…
Q: Researchers are designing and testing antisense drugs as therapies for a variety of diseases,…
A: An antisense drug is a medication containing part of the non-coding strand of messenger RNA, a key…
Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 2. What are IC TArE Codon marks theste at wNch translati PART D. Directions: Identify the mutated…
A: In the given question the normal DNA is TAC-CCC- GTC- ACC- GCC- TAT-ATC. The normal RNA formed from…
Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…
A: Gene expression is the process by which the instructions in our DNA are converted into a functional…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…
Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…
A:
Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…
A: The translation is a process by which proteins are synthesized. It is the last step of the central…
Q: Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence…
A: Introduction :- The proteins are synthesized with the help of protein synthesizing machinery which…
Q: When using gene therapy to treat an hereditary disease, the idea is to: A. Introduce the correct…
A: Genes are the functional segment of DNA which encode for proteins.
Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…
A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…
Q: All of the following occur when the amino acids of two tRNA molecules are joined, except. a. The…
A: DNA replication, transcription, and translation are the molecular processes that are responsible for…
Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…
A: Gene expression is the process by which the instruction in the DNA is converted to products through…
Q: point mutation (SNP) is sufficient to cause a genetic disorder if a. It causes a change at the…
A: SNPs (single nucleotide polymorphisms) are polymorphisms induced by point mutations that result in…
Q: 2. Use the MRNA sequence to find the DNA sequence and the amino acid sequence. DNA MRNA-…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…
Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…
A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…
Q: 9The table opposite shows the triplet codes for the 20 amino acids involved in protein synther A…
A: Codons are three DNA sequence triplets that code for specific amino acids and there are a total of…
Q: 1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of…
A: Introduction: The changes or alteration in the sequence of DNA is known as mutation.
Q: Which of the following describes the effect of a frameshift mutations? * A. all mRNA codons change…
A: Cental dogma is the process via which DNA is transcribed into mRNA then the mRNA is translated to…
Q: Which of the following statements below is incorrect? * A. the genetic code is overlapping B.…
A: As per guidelines, you have asked multiple questions we will solve the first question for you. If…
Q: n bacteria the ribosome is positioned next to the start codon by A the ribosome binding site B…
A:
Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…
A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…
Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…
A: DNA acts as genetic material in most organisms. DNA gets transcribed into mRNA by an RNA polymerase…
Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC 5' АTG CТА СТС…
A: No, this mutation might not change the way in which the protein functions. In this mutation the…
Q: . An alternative form of a gene is called an
A:
Q: Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting…
A: Central dogma- RNA is produced from DNA with the help of transcription and then RNA is converted to…
Q: B. Transcript and Translate the following: DNA-TACTGATCGACCCCCATA ATGAAAATCGGGCCC MRNA- AA- DNA -…
A: Coding DNA strand and mRNA has same sequence except T in DNA and U in RNA mRNA - Complementary to…
Q: 2. Muscular dystrophy is a genetic disorder that causes progressive muscle weakness as individual…
A: Muscular dystrophy It is a genetic disorder, in this disease the muscle of the individual weakens.…
Q: A begins as a short segment of the double helix is unwound by A.The RNA polymerase binds to the…
A: Gene expression Gene expression is the process by which a gene is inside for its specific product.…
Q: 5′ capping is the first step in ......... processing. a. mRNA b. tRNA c. pre-RNA
A: 5' capping is the first step in mRNA processing. In the first nucleotide in the transcript during…
Q: Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes…
A: The mRNA at the third position is AUG and it is called Initiation codon.
Q: 2. An mRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Introduction DNA is the hereditary material in humans and almost all other organisms. RNA is used to…
Q: 1. Below is a sequence of DNA bases. =T ACTTCACG AGTGAGACT a) Transcribe to MRNA: AUGAAGUGCUCACUCUGA…
A: Transcription is a process in which the DNA sequence is converted to mRNA. In mRMA there is Uracil…
Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…
A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…
Q: Given the following DNA sequence from the template strand of a given gene:…
A: Codon is a sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…
Q: What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below?…
A: There are two strands of DNA :- template and coding strand . Template strand read in 3' to 5'…
Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC TGA ACT 5' 5 ATG…
A: Mutations are changes in the base pair that can effect the way proteins and mRNA is formed it can…
Q: A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic…
A: Cystic fibrosis is a disesase that damage the cell producing mucus, sweat and other juices. in…
Q: b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand DNA…
A: The mRNA is produced from the DNA template by the transcription process and then mRNA is used for…
Q: Which statement is CORRECT? O the primary transcript of RNA is larger than the mRNA O the primary…
A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…
Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…
A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…
Q: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' is % of guanine in DNA fragment A is the 4th…
A: As per our company guidelines, we are supposed to answer only first 3 sub-parts. Kindly repost the…
Q: A. Taq polymerase B. Release factors C. Reverse transcriptase D. CDNA 1. Catalyzes peptide bond…
A: 1. H peptidyl transferase 2. G aminoacyl tRNA synthetase 3. K shine dalgarno sequence 4. I…
Q: 2. Muscular dystrophy is a genetic disorder that causes progressive muscle weakness as individual…
A: Mutations are the change in the DNA sequence that it leads to several disorders. mutations can be a…
Q: 1. Bradykinin peptide: a) The sequence of the gene that encoded it, indicating with different…
A: Note- As per guidelines, we are author to answer only first-three sub parts of first question only.…
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…
A: Translation is process in which proteins are synthesized.
Q: 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5'…
A: The translation is a process in which the synthesis of protein is done from the mRNA. The sequence…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome? Complementary mRNA Resulting Amino Acid Row A B D. OC. C D. D C Select one: OA A OB B Mutated DNA ATG ATG ACT ACT Metabolic syndrome is a genetic disorder with symptoms such as hypertension, elevated blood cholesterol, and low blood magnesium concentrations. This syndrome is caused by a mutation in which a cytosine nucleotide in the codon ACG is replaced by a thymine nucleotide. Use the following to answer the next AUG UAC ACU UGA Methionine Tyrosine Threonine StopWrite down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence
- Below is the sequence of MRNA. 1. if U is mutated to C, then it will lead to a [ Select ) mutation. 2. if U is mutated to A, then it will lead to a ( Select ) mutation. 3. if U is mutated to G, then it will lead to a ( Select) mutation. MRNA G Mutation 1 G Mutation 2 Mutation 3 Second letter A G UU* Phe UUC UCU) UCC UCA UAU Tyr UACS UGU cys UGC Ser UAA Stop UGA Stop UAG Stop UGG Trp G UUA UUG Leu UCG CUU CAU His CAC CGU CGC CUC CUA CUG CCU ССС CCA CG Leu Pro Arg САА CGA Gln CAG, CGGJ AAU Asn AGUser AGC AUU AUC Fle AUA AUG Met ACG ACU ACC AAC Thr ACA AAGLYS AGA TArg GCU GCC GCA GCG GAU Asp GAC. GUU GUC Val GUA GGU) GGC Gly Ala GAA Glu GAG, GGA GUG GGG Third letter DUAG PUAG DUAG PUAG First letterFinally, imagine that a mutation occurred in the codon below and an A was inserted between the two Ts. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T A T G This would be an example of which type of a mutation?__________________________Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid A T G A T C This would be an example of which type of a point mutation?__________________________
- Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T T C This would be an example of which type of a point mutation?__________________________Procedure This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the following sequences of the first thirty (30) nucleotides: TAC CAC GTG GAC TGA GGA CAC CTC TTC AGA... 1. First transcribe the DNA sequence into the mRNA sequence. 2. Refer to the genetic code to write down the amino acid sequence that these 30 nucleotides encode beginning with the first nucleotide. 3. Generate a random number (1-30) by drawing lots in a bowl. Then locate the DNA nucleotide to "mutate" using the number drawn as the position along the gene. 4. "Roll" the tetrahedron "mutator" dice (see direction below for making the tetrahedron "mutator" dice). Note the letter on the side that is flat on the table. That is the nucleotide that will replace the nucleotide in the DNA at the position decided in the previous step. 5. Write the mutant nucleotide sequence in the row for Mutation 1, then analyze mutation. a. If it is the same nucleotide, write same nucleotide…Analysis of a mRNA sample showed that 18% of the nitrogen-base molecules present were uracil molecules. The DNA molecule that was transcribed to form the mRNA sample would most likely contain Select one: a. 18% adenine b. 18% cytosine c. 32% thymine d. 32% adenine O O O
- 3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.thank youConsider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the sequence of the DNA strand that would be replicated from this one. GTACACATCAGATT 2. White the sequence of the messenger RNA (MRNA) molecule that would be transcribed from the DNA strand. 30 GUACACAUCAGAU00 37 38 39 3. State how many codons the sequence specifies. 40 41 42 43 44 4. State how many amino acids the sequence specifies. 45
