Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
Which DNA strand is complementary to this template strand: 5’-GACGCT-3’?
- A. 5’-AGCGTC-3’
- 3’-AGCTAG-5’
- 5’-GACGCT-3’
- 3’-GATCGA-5’
- 5’-UCGAUC-3’
Which mRNA strand is transcribed from the above template DNA strand (the original)?
- 5’-GAUCGA-3’
- 3’-CUGCGA-5’
- 5’-CUAGCU-3’
- 3’-TCGATG-5’
- 5’-AGUGUC-3’
Which tRNA anticodon is complementary to the first mRNA codon (above)?
- 5’-GAU-3’
- 3’-UAC-5’
- 5’-AGC-3’
- 3’-CGU-5’
- 5’-GCU-3’
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- From the following DNA template, which sequence is synthesized by RNA Polymerase? 5’- T – C – C – T – A – A – G – A –3’ Group of answer choices 5’- A – G – G – A – T – T – C – T –3’ 5’- U – C – C – U – A – A – G – A –3’ 3’- A – G – G – A – U – U – C – U –5’ 3’- T – C – C – T – A – A – G – A –5’ 3’- T – G – G – A – T – T – C – T –5’arrow_forwardProduce the RNA strand that would be read from the DNA strand T -- A C -- G C -- G A -- A -- C -- G -- T -- T-- A -- ف في نarrow_forwardThe original wild-type" DNA strand is: 5'-ATGGGACTAGATACC-3'. Which allele is least likely to show a mutant phenotype? First letter A U UUU UUC UUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala 5'-ATGGGATAGATACC-3' ● 5'-ATGGGTCTAGATACC-3' O 5'-ATGCGACTAGATACC-3' O 5'-ATGGGACTAGTTACC-3' CAU CAC CAA CAG UAU Tyr UAC UAA Stop UAG Stop UGG Trp AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu UGU UGC Cys UGA Stop A CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg DOAG JOAG DO AO | DOA Third letter Gly C Garrow_forward
- Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the nucleotide sequence of the DNA strand complemantary to sequence given above B Give the sequence of nucleotide in the Mrna that would be synthesized if the complementary strand in the answer above is used as a template during transcriptionarrow_forwardDNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLYarrow_forward5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’>3’ direction.arrow_forward
- Which of the following is a section of MRNA produced from the DNA template below? 3' ATAGCTA 5' O 5'UAUCGAU 3' O 5'ATAGCTA 3' O 5'AUAGCUA 3 5'TATCGAT 3'arrow_forwardE.coli is replicating its chromosome. If the template DNA sequence is: 3' AAA CGC GAT 5', what would be the base sequence of the complementary new DNA strand? O 5'TTT GCG CTA 3' 5' UUU GCG AAU 3' O 3' UUU GCG AAU 5' O 3' TTT GCG AAT 5'arrow_forwardWhich of the following sequences is the best description of the complementary DNA sequence to the following sequence: 5'-CGATTAGC-3' Group of answer choices 5'-GCTAATCG-3' 5'-GCUAAUCG-3' 3'-CGATTAGC-5' 3'-GCUAAUCG-5' 3'-GCTAATCG-5'arrow_forward
- A cytosine deamination occurs in the top strand of the following DNA duplex 5'-gATTACA-3'3'-CTAATgT-5' The duplex is then replicated before the deamination is repaired. What will be sequence of the newly synthesized bottom strand? Your answer should read 3' to 5'arrow_forwardWhich primer would bind to this coding strand as a reverse primer? 5'- ATGGCCAAAT GATTCCCACG ATTTGGCCAT TGAGATCCGG - 3' O3'- ATGGCCAAAT - 5' O 5'- CCGGATCTCA - 3' O 5'- ATGCGCAGAT - 3' O3'- CCGGATCTCA - 5' Narrow_forwardBamHI recognizes 6 base pairs of DNA in a palindromic DNA sequence. If the first part of the sequence is given below, what is the rest of it? 5' C 'A A А 3' ОА. 5' САА З' ОВ. 5' ААС З' C. 5'TTG3' D. 5'GTT3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education