Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
What is the RNA sequence transcribed from the coding strand DNA with the sequence of 5’-ATGT-3’?
5’-ATGT-3’
5’-TGTA-3’
5’-AUGU-3’
3’-UACA-5’
3’-TUCU-5’
3’-TACA-5’
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 4 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Transcribe the following strand of DNA into RNA: 5'-AAGTTCGA-3'arrow_forward#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:arrow_forwardThe diagram represents DNA that is part of the RNA-coding sequence of a transcription unit. The bottom strand is the template strand. 5'-GCATATGCGGTAC-3' 3'-CGTATACGCCATG-5' Give the sequence found on the RNA molecule that is transcribed from the above DNA molecule. Enter your answer from 5' to 3'. 5'- -3'arrow_forward
- DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC TTT GCA TTA 5' The DNA strand that is capable of forming a hairpin looparrow_forwardWhat is the DNA complement to this DNA sequence: TGAGCCTTAGGA? O UCTCGGUUTCCT O ACTCGGAATCCT O ACUCGGAAUCCUarrow_forwardWhat is the consensus sequence of these three DNA sequences? 5' - G G T G C A C - 3'5' - A A T T C A C - 3'5' - G G T T C T C - 3'arrow_forward
- Figure 1 shows that remdesivir "mimics" an important component of RNA replication. Which component of RNA replication has a structure similar to that of remdesivir?arrow_forwardWhat is the anti-codon for the tRNA Ser that matches the mRNA codon (5'-AGU-3')? a 5'-UCA-3' b 5'-AGU-3' c 5'-ACU-3' d 5'-ACT-3' e 5'-AUG-3'arrow_forwardWrite down the complement strand of DNA for the following sequence and place the 3' and 5' on the appropriate ends. 3' - GGGCCTAATATAGCTTTACGGTAT - 5'arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education