Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'

Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'

Name: Which of the following strands of DNA (assuming it was bound to its co
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a.5' - CCGCCGGCATATCCGAT - 3' b.5' - CCGCGCGATCGGCGCGT - 3' c.5' - AATGAGGCCAATT

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 9SA: Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from...

See similar textbooks

Similar questions

Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ________. a. the nucleotide b. DNA polymerase c. phosphate-group transfers from ATP
Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the most difficult to break apart? O a. 5'- CCGCCAAGGCAT - 3' O b. 5' - CAATTAGTTAAC - 3' O C. 5'- AAATTGATATAT - 3' d. 5'- AATGCGCCGATA - 3' e. 5'- CCAGGCCGTGGA - 3'
Which of the following DNA molecules is complementary to the sequence: 5'-ATTGCGTAC - 3¹? O a. 5'-TAACGCATG-3' O b.5'-AUUGCGUAC-3' O c. 5'- UAACGCAUG - 3' O d. 5'- GTACGCAAT - 3' O e. 5'- UTTGCGTUC - 3¹
Write the sequence of the complementary strand of each segment of a DNA molecule. a. 5 '–AAATAAC–3 'b. 5 '–ACTGGACT–3 'c. 5 '–CGATATCCCG–3 'd. 5 '–TTCCCGGGATA–3
The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' O b.5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' e. 5' - AAUCCACUUGUACGCUAU - 3' QUESTION 37 The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What sequence of amino acids would be produced as a result of transcribing and translating this DNA template? a. Met - Asn - Leu - Phe - His - [STOP] Ob. Tyr - Arg - Met - Phe - Thr - [STOP] O C. Asn - Pro - Leu - Val - Arg - Tyr d. Met - Phe - Thr - [STOP] e. None of the above O O O O
The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' b.5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' O e. 5' - AAUCCACUUGUACGCUAU - 3'
One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on the other half? A. CGATTCCGCAATAGGGG B. GCTAAGGCGTTATCCCC C. CGATGCCGCAATAGGGG D. ATAGGAATACCGCTTTT E. TATCCTTATGGCGAAAA
One strand of DNA has the sequence 5'-GCT-3'. What is the sequence of the complementary strand? A. 5'-TCG-3' B 5'-CGA-3' C. 5'-GCT-3' D. 5'-AGC-3'
A new type of nucleic acid molecule is found have a base composition of 29% adenine, 19% thymine, 21% cytosine and 31% guanine. The molecule is probably: a. single stranded DNA b. double stranded RNA c. double stranded DNA d. single stranded RNA
The two strands of a DNA double helix can be separated by heating. if you raised the temperature of a solution containing the following three DNA molecules, in what order do you suppose they would “melt”? explain your answer.A. 5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ B. 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’C. 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’
If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following sequence: a. 3'-AATGCTAC-5' b. 3'-CATCGTAA-5' c. 3'-TTACGATG-5' d. 3'-GTAGCATT-5'
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity